ORFeome > gk ORF1 – XORFeome v1.0

gk ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gk
Gene ID: 961547
Gene Page ID: 961540
ORF Xenbase ID: 17277141

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056091
Original XGC clone length: 1692

Human orthology & disease relationships

NCBI Entrez ID: 2710
Ensembl gene IDs: ENSG00000198814
Directly associated (OMIM) disease MIM numbers: 307030
Indirectly associated (Lage, et al.) disease MIM numbers: 105830,139300,227650,231300,270200,300000,307030,604229,608902,609535

Library Location

Plate ID: GDExl11021
Well Location: E04

Sequences - 5ʹ (forward) EST

Accession: JZ824719
dbEST ID: 79642421
Trimmed Sequence: ATGGCCGCGTCCAACAGAGTTATTCTGGGACCTCTGGTGGGAGCCATTGACCAAGGAACGAGTTCGACACGATTTCTGGTTTTTAATGCAAAAACAGCAGAACTGCTAAGCCACCATCAAGTAGAAATCAAACAAAAGTTTCCAAAAGAAGGATGGGTAGAGCAAGATCCAAAGGAAATTTTACGGTCTGTTTATGAATGTGTAGAGAAGACGTGTGAGAAGCTGACCCAACTAAACATTGACATCACAAATATCAAAGCAATTGGAGTCAGTAACCAAAGGGAAACAACTGTGGTGTGGGACAAGACAACAGGAGAGCCTCTGTACAATGCTATTGTTTGGCTAGATTTGAGAACACAATCAACTGTAGAACGACTTTTAAAAAGAATTCCAGGCAAAAATAAGAATTTTTTCAAGAGTCGGACTGGTCTTCCACTTAGCACTTACTTCAGTGCAGTGAAAATTCGATGGCTTCTAGACAATGTGGAAGAGATTAGACATGCTGTTTCAGAGGGAAGAGCAATGTTTGGAACAGTTGATTCCTGGATCATTTGGAGTCTTACTGGTGCAAAGAATGGAGGGGTGCATTGTACAGATGTGACCAATGCCAGCAGAACAATGCTGTTTAATATTCATACATTGGAATGGGACACAGAGCTCTGCCAGTTTTTTGATTACCTATGGAATTATTTGCAAAAGTGAGAAGTTCATCAGAGATCTACGGGTCTAATGAAAATCTGTCCCTAACCCGAAATCTGGAGCTTTTTACGGAGGTCCAAAATTTTGGGGGGGTTTTTGAAAACCAGCCCACCTGGCTTTAATTTAGGAAAAAAA
Full Trace Sequence: AATGAATTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCGCGTCCAACAGAGTTATTCTGGGACCTCTGGTGGGAGCCATTGACCAAGGAACGAGTTCGACACGATTTCTGGTTTTTAATGCAAAAACAGCAGAACTGCTAAGCCACCATCAAGTAGAAATCAAACAAAAGTTTCCAAAAGAAGGATGGGTAGAGCAAGATCCAAAGGAAATTTTACGGTCTGTTTATGAATGTGTAGAGAAGACGTGTGAGAAGCTGACCCAACTAAACATTGACATCACAAATATCAAAGCAATTGGAGTCAGTAACCAAAGGGAAACAACTGTGGTGTGGGACAAGACAACAGGAGAGCCTCTGTACAATGCTATTGTTTGGCTAGATTTGAGAACACAATCAACTGTAGAACGACTTTTAAAAAGAATTCCAGGCAAAAATAAGAATTTTTTCAAGAGTCGGACTGGTCTTCCACTTAGCACTTACTTCAGTGCAGTGAAAATTCGATGGCTTCTAGACAATGTGGAAGAGATTAGACATGCTGTTTCAGAGGGAAGAGCAATGTTTGGAACAGTTGATTCCTGGATCATTTGGAGTCTTACTGGTGCAAAGAATGGAGGGGTGCATTGTACAGATGTGACCAATGCCAGCAGAACAATGCTGTTTAATATTCATACATTGGAATGGGACACAGAGCTCTGCCAGTTTTTTGATTACCTATGGAATTATTTGCAAAAGTGAGAAGTTCATCAGAGATCTACGGGTCTAATGAAAATCTGTCCCTAACCCGAAATCTGGAGCTTTTTACGGAGGTCCAAAATTTTGGGGGGGTTTTTGAAAACCAGCCCACCTGGCTTTAATTTAGGAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCGCGTCCAACAG

Sequences - 3ʹ (reverse) EST

Accession: JZ830071
dbEST ID: 79647773
Trimmed Sequence: TTTATTAAGACCTGAGATGTACTTTGCTCCGATTAATAATACCATGCTACTCACTATATAAAGCCCCAGAGGAAGACTACAGAAGATACTACAGTCACCATTTCCATTGGAGGTAGGCTCTGCTGATTCCCAGTCCATTGATTTCAACACTGCCTTTTTCCATCTAGCATATCGAAATTCACTTTCTTCTGGGTTGATTTGTGGTTCAAACCGTTCACATGTTACAGCAGTTAAATCTCCAGGATTTAGGCTCCAGACGCCAACACCTTCAGCAGCGCCTGCAGCCATAGCAGCACCCAGTGCAGTTGTTTCAGGCATGGATGGTTTCACTACTGGAATGCACAGTATATCAGCCTGCAACTGCATTAGGATTTTGTTGCTTGTCATACCCCCATCAACCTGAAGTTGATTGAGAGGAATGCCACAATCTTGGTTCATAGCATCCAGAATCTCTCTAGTCTGGAAACACACAGCTTCAAGAGCAGCAAATGCAATATGGTTTCTGTTTGTAAACTGGGTGAGGCCACAGATGATACCTCTGGCACTCGGCTCCCAATAGGGAGCGTATAAACCTGAAAATGCAGGAACAAAGTAGCAGCCATATGACGTCCCAACTTCAGCAGCGAGTTTTTCTACTTCCTCAGTAGTCTTCACAATTCCAAGATTGTCTTCTCACCAGCGTACTACTGCTTCCGGCTATGGCAACCTGACCCCTCGAGGGCATTAAACAGGGCCGGGTGGTATCCCCTTTCCC
Full Trace Sequence: TGACAGGCATCAGCTATGACCATGTAATACGACTCACTATANGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTATTAAGACCTGAGATGTACTTTGCTCCGATTAATAATACCATGCTACTCACTATATAAAGCCCCAGAGGAAGACTACAGAAGATACTACAGTCACCATTTCCATTGGAGGTAGGCTCTGCTGATTCCCAGTCCATTGATTTCAACACTGCCTTTTTCCATCTAGCATATCGAAATTCACTTTCTTCTGGGTTGATTTGTGGTTCAAACCGTTCACATGTTACAGCAGTTAAATCTCCAGGATTTAGGCTCCAGACGCCAACACCTTCAGCAGCGCCTGCAGCCATAGCAGCACCCAGTGCAGTTGTTTCAGGCATGGATGGTTTCACTACTGGAATGCACAGTATATCAGCCTGCAACTGCATTAGGATTTTGTTGCTTGTCATACCCCCATCAACCTGAAGTTGATTGAGAGGAATGCCACAATCTTGGTTCATAGCATCCAGAATCTCTCTAGTCTGGAAACACACAGCTTCAAGAGCAGCAAATGCAATATGGTTTCTGTTTGTAAACTGGGTGAGGCCACAGATGATACCTCTGGCACTCGGCTCCCAATAGGGAGCGTATAAACCTGAAAATGCAGGAACAAAGTAGCAGCCATATGACGTCCCAACTTCAGCAGCGAGTTTTTCTACTTCCTCAGTAGTCTTCACAATTCCAAGATTGTCTTCTCACCAGCGTACTACTGCTTCCGGCTATGGCAACCTGACCCCTCGAGGGCATTAAACAGGGCCGGGTGGTATCCCCTTTCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTATTAAGACCTGAGATGTA