ORFeome > glb1l ORF1 – XORFeome v1.0

glb1l ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: glb1l
Gene ID: 964701
Gene Page ID: 964695
ORF Xenbase ID: 17277171

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124927
Original XGC clone length: 1938

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11082
Well Location: F11

Sequences - 5ʹ (forward) EST

Accession: JZ837285
dbEST ID: 79654987
Trimmed Sequence: ATGATGTGGCTGTGGGCGACTTTACGCATTTTTCTAATGGTGGTTGTATATGGCTCAGTCAGCACAACATCCTCAAGAACGTTTGAGATAGATTTTGAGCACAATTGTTTTCGTAAAGATGGGCAGCCTTTCCATTACATTTCAGGAAGTATTCATTATTCTAGAATTCCACAATTTTATTGGAAAGACCGCCTACTGAAGATGAAGATGGCAGGATTAGATGCTATTTACACTTATGTACCATGGAATTTCCATGAGACAAAGCCAGGTGTTTACAACTTTTCTGGAGATCATGATATTGAGTCATTCTTGAAACTTGCAAATGAAATTGGGCTGCTGGTGATCCTGAGAGCAGGTCCTTACATATGTGCAGAATGGGACATNGGGAGGTTTGCCAGCATGGCTTCTAGCAAAAGAATCAATTGTCCTTCGAAGTTCTGATCCAGATTATCTTCAGGCTGTGGATAATTGGATGGGGAGTGTTTTTGCCCAAGATGAGACCTTTGTTGTATCACAATGGCGGCCCAATTATAAGTGTCCAGGTTGAAGATGAGTATGGCAGCTATTTTACTTGTGATTACGATTATCTACGACATCTCTTACCACTTTTCCTCCTCCCTTAAGGGACGAGGTGAATTTATTCACAACTGATGGCTCCTGCCTACGGCCTGGAAAGGGCGGAACGAGTCGAGGCTTATACACAACGGTAAAATTTTGGAACAGGTTCCCAGAATTACTGGAACCATTTTTTATTTCTAAAACCTTTTTAGACCCAAAAGGGAGCGGTTGGATATATTCCGAAAATTTCTTAACACCGACGC
Full Trace Sequence: GGCGGGCCCAAATAATAGATTTTATTTNTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATGTGGCTGTGGGCGACTTTACGCATTTTTCTAATGGTGGTTGTATATGGCTCAGTCAGCACAACATCCTCAAGAACGTTTGAGATAGATTTTGAGCACAATTGTTTTCGTAAAGATGGGCAGCCTTTCCATTACATTTCAGGAAGTATTCATTATTCTAGAATTCCACAATTTTATTGGAAAGACCGCCTACTGAAGATGAAGATGGCAGGATTAGATGCTATTTACACTTATGTACCATGGAATTTCCATGAGACAAAGCCAGGTGTTTACAACTTTTCTGGAGATCATGATATTGAGTCATTCTTGAAACTTGCAAATGAAATTGGGCTGCTGGTGATCCTGAGAGCAGGTCCTTACATATGTGCAGAATGGGACATNGGGAGGTTTGCCAGCATGGCTTCTAGCAAAAGAATCAATTGTCCTTCGAAGTTCTGATCCAGATTATCTTCAGGCTGTGGATAATTGGATGGGGAGTGTTTTTGCCCAAGATGAGACCTTTGTTGTATCACAATGGCGGCCCAATTATAAGTGTCCAGGTTGAAGATGAGTATGGCAGCTATTTTACTTGTGATTACGATTATCTACGACATCTCTTACCACTTTTCCTCCTCCCTTAAGGGACGAGGTGAATTTATTCACAACTGATGGCTCCTGCCTACGGCCTGGAAAGGGCGGAACGAGTCGAGGCTTATACACAACGGTAAAATTTTGGAACAGGTTCCCAGAATTACTGGAACCATTTTTTATTTCTAAAACCTTTTTAGACCCAAAAGGGAGCGGTTGGATATATTCCGAAAATTTCTTAACACCGACGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGTGGCTGTGGGCGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837284
dbEST ID: 79654986
Trimmed Sequence: GTGAATTTTTTCTTTGCTGAATATGTGTTCATCAGCAGATTGATTTACTTTATTGAGAACTGGCTTGTCCACAAACTCCACAACACATTTTCCACTGTTGCAAGGAGAATTTTCCAGCTCTAGTACAGTAATGTTGTTAATTTGAGTTGTTGTTAAAATGTTCCTGGGAACATACAAGGTAACCTGAGGACCTCTTACTGGCCAGTACCGCCCCAGGTTAAATCCATTGATCCATATCTGTCCTTTTGTCCATCCTGGAAATTGAATAAAGGTATCCTGGGGTAATTGTGGAATTCCAGTGGGAATAATTAGGCTGCCTTTGTAAAACGTCGGAGCTGAAAAGGTGGACGTATATGGACTATGAATGGTGGACAAAAGCCCACTATTAATATCACTACCTATGTCTAGAGGGTACGTTGTCTAGTTCACTAGCGTCTCTCCATTGAGGGTTACATTGGTGTGCAAACCCTTAAAATCATTATTGTATCTTCCAAATTAAGCCTACCCATACTTTCCCCCATCAAGTCCAGTGCTGCTCCCCCTTCCTCAGTTACCTTTATAGCTTCTCTGCTCATCTCTTTTCAGAAAAAAATTGTGGAATCCCCATTAACCATTAACGTACGCCACGGTCCCGGACGTGGGTGGAAATAAACAAAATCACTGGTTGATGGAATTACTTGGAATTTGAT
Full Trace Sequence: GGCATTCTGCTACTGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGAATTTTTTCTTTGCTGAATATGTGTTCATCAGCAGATTGATTTACTTTATTGAGAACTGGCTTGTCCACAAACTCCACAACACATTTTCCACTGTTGCAAGGAGAATTTTCCAGCTCTAGTACAGTAATGTTGTTAATTTGAGTTGTTGTTAAAATGTTCCTGGGAACATACAAGGTAACCTGAGGACCTCTTACTGGCCAGTACCGCCCCAGGTTAAATCCATTGATCCATATCTGTCCTTTTGTCCATCCTGGAAATTGAATAAAGGTATCCTGGGGTAATTGTGGAATTCCAGTGGGAATAATTAGGCTGCCTTTGTAAAACGTCGGAGCTGAAAAGGTGGACGTATATGGACTATGAATGGTGGACAAAAGCCCACTATTAATATCACTACCTATGTCTAGAGGGTACGTTGTCTAGTTCACTAGCGTCTCTCCATTGAGGGTTACATTGGTGTGCAAACCCTTAAAATCATTATTGTATCTTCCAAATTAAGCCTACCCATACTTTCCCCCATCAAGTCCAGTGCTGCTCCCCCTTCCTCAGTTACCTTTATAGCTTCTCTGCTCATCTCTTTTCAGAAAAAAATTGTGGAATCCCCATTAACCATTAACGTACGCCACGGTCCCGGACGTGGGTGGAAATAAACAAAATCACTGGTTGATGGAATTACTTGGAATTTGAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGAATTTTTTCTTTGCTGAATA