ORFeome > gldc ORF1 – XORFeome v1.0

gldc ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gldc
Gene ID: 1221326
Gene Page ID: 1221321
ORF Xenbase ID: 17277189

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC042245
Original XGC clone length: 3075

Human orthology & disease relationships

NCBI Entrez ID: 2731
Ensembl gene IDs: ENSG00000178445,LRG_643
Directly associated (OMIM) disease MIM numbers: 605899
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11016
Well Location: F02

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: CCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAATAACTTGGGTGAACGCTATCCTATGTCACCTCCTGGCCGATCCTTGATTGCCGTACTAATTCCGAAGGAGCATTCGACAAGCGGCCGCAAGAGAAACTCTTGGCCCCACAAGAATTGTACTTATTTGTCTTTCCGGACTTTAACTGCGCCGTGGTCTCCGCTCAATTCCGTCTCCCCCCAAGTCCACTGACTGCCCCAGCCACATGCCTCTGACTGCTCCTAAAGACGCCTCTGCCACAGATACACGGAGGAACATCCGATGCTTTACTCCCCCATTCTCCCTGACTTAGCTCAGTGTAAATGTCAATACATCGTCCCTGGTACCACCTCGGCCTGGATCACCTCTCATTATGGATGATCTTGTAACCGCTAACGTGCCTCTCGACTCCTCCCTTTCTACCAACCGATGGCACAAGACTCTCCCAGGTCCTACATAGGACACGGGCTACTTACTTTGTCTCCTTCCTCATCGTCCATCACAAGTCTTAATGCAGCACGCAGGCTGTCTCGCGCTGCAGACCCCATATCCGACTGCGGGGCCCCAATACCGACTAAATAGCTTACTCATTTACACTACATATGTGTGTGACCTACACTGGTATGTACTCTGCTTATGATGCGCTACCAGATTAAAGATCATCAGCTTCAGATGACATGCCGTTACGCCACACACTCTCTTGTACAAGGATATTCATCTATGGACAATAGATGCCTTTCTCTTTCAATGCACCGAACTACGTCACAATAGCATCTTACATTGATCATTCAATCGTGCATCCGCTGTTTATCTCCCCAAAATGGGACTTCAGTATGGAAAAGGAATCCCAAGTGGGGTTTCCCGGGTTCCCCTCACCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGAGCTGTGCCAAGT

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: CCTGGAATCAGCTATGACCATGTAATACGACTCACTATANGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGACAAAGAAGAGGCTCTCTTCTGTTCTGTAAAAGTGATATTCTTTAGACCTCCATTGGTGGACAAGTACAAACCACTTGCTGATCACCATAAATGTCATCCAATCATGCAATGAATGGCCTGAATTTGCTCACTGGTCTGACAAATGGTAAGGGAAACGCACCCACTTCTCTTGAATAAGGACGATCCCAAATGAAAGATGACCTGCTCGTCAATGTATGTGGAGCCGTTTTTACTGTATTAATCCTTGAGTCCATTCTGCCTTCCTCAATATCATCAATCTCCTGCCTGATGCTAATAATCTCATCCCATAACCGATCCATCTCGGCATTATCTTCAGACTCATTTGGCTCATTCATTAGAGTTCCTGCCACTGGCCAGGACATGGTAGGTGCATGATATCCATAATCTTGCACTCTCTATTGCTACATCTACTGCCTCAATGTTTGCATACTTCTTGAACGGTCTTACATCCAGAGTGAATTCATGAGCAACAAATCCTCTAAATCCCTTGAATATGATTTTGTAGTGTTTATCTAGTCTCTTTGCCATATACTTGGCATTCTACATGGTCACTTCTGCAGCATGTTTCACTCCTTTTACTCCCATCATCATTATGTAAGCCCAAGATATATGACAGAATGCACTGGGACCCCATGTGTGCAGCACTAATAGGTCCCCAAACTGGAAGTATGGTCATTTGTAAAAGCAAATGACGGGGTTGCCTGGGCAATTAAAAGGGAAAAGATTTTTTCTTTACCCCCATCCTGGCCCCGTGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGAGGAGGCTCTCTTCTGT