ORFeome > glrx5 ORF1 – XORFeome v1.0

glrx5 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: glrx5
Gene ID: 972927
Gene Page ID: 972921
ORF Xenbase ID: 17277237

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099281
Original XGC clone length: 465

Human orthology & disease relationships

NCBI Entrez ID: 51218
Ensembl gene IDs: ENSG00000182512
Directly associated (OMIM) disease MIM numbers: 205950
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11007
Well Location: C04

Sequences - 5ʹ (forward) EST

Accession: JZ840166
dbEST ID: 79657868
Trimmed Sequence: ATGAGTTGGTGTTTGAGCAAAGTCTCCGCGGCTGTTCTGCGAGGGAGCGCTAGGACTCCGCAGGCCTGTGGCTCCTTATCCGTCCTGCGATGGCTTAGTTCAGACAGCGTATCGCCCGAGCACTTAGACGGCTTGGTGAAGAAGGACAAAGTGGTGGTGTTCATCAAGGGCACCCCGGCCCAACCCATGTGCGGCTTTAGCAACGCGGTGGTGCAGATACTCCGCATGCATGGAGTGAACGACTATGCGGCCTATAATGTGCTGGAGGACCAGGACCTGAGGCAGGGGATAAAGAATTATTCAAACTGGCCCACCATACCTCAGGTCTACTTTAATGGTGAATTTGTGGGAGGCTGTGATATCCTACTTCAAATGCATCAGAATGGAGACCTTGTAGAAGAGCTGAATAAGTTGGGAATTCGCTCTGCGTTGTTAGATGCTGAACCAAGCCAAGAGAAAAAGTT
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTTGGTGTTTGAGCAAAGTCTCCGCGGCTGTTCTGCGAGGGAGCGCTAGGACTCCGCAGGCCTGTGGCTCCTTATCCGTCCTGCGATGGCTTAGTTCAGACAGCGTATCGCCCGAGCACTTAGACGGCTTGGTGAAGAAGGACAAAGTGGTGGTGTTCATCAAGGGCACCCCGGCCCAACCCATGTGCGGCTTTAGCAACGCGGTGGTGCAGATACTCCGCATGCATGGAGTGAACGACTATGCGGCCTATAATGTGCTGGAGGACCAGGACCTGAGGCAGGGGATAAAGAATTATTCAAACTGGCCCACCATACCTCAGGTCTACTTTAATGGTGAATTTGTGGGAGGCTGTGATATCCTACTTCAAATGCATCAGAATGGAGACCTTGTAGAAGAGCTGAATAAGTTGGGAATTCGCTCTGCGTTGTTAGATGCTGAACCAAGCCAAGAGAAAAAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCGGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGAAACACTGGACCCGTGTTCAAAATTCCTGATGTTACAAGGCCGGGCGGTGNGGGCCGCGGCCGCCTCCCCCTCCCCGCCCCTTTTTCCTTTTTTGCTTCTTTTTGGGTGAAAGAACCAACACCAAAAACAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTTGGTGTTTGAGCAAAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ840165
dbEST ID: 79657867
Trimmed Sequence: CTTTTTCTCTTGGCTTGGTTCAGCATCTAACAACGCAGAGCGAATTCCCAACTTATTCAGCTCTTCTACAAGGTCTCCATTCTGATGCATTTGAAGTAGGATATCACAGCCTCCCACAAATTCACCATTAAAGTAGACCTGAGGTATGGTGGGCCAGTTTGAATAATTCTTTATCCCCTGCCTCAGGTCCTGGTCCTCCAGCACATTATAGGCCGCATAGTCGTTCACTCCATGCATGCGGAGTATCTGCACCACCGCGTTGCTAAAGCCGCACATGGGTTGGGCCGGGGTGCCCTTGATGAACACCACCACTTTGTCCTTCTTCACCAAGCCGTCTAAGTGCTCGGGCGATACGCTGTCTGAACTAAGCCATCGCAGGACGGATAAGGAGCCACAGGCCTGCGGAGTCCTAGCGCTCCCTCGCAAAACAGCCGCGGAGACTTTGCTCAAACACCAACTCATGG
Full Trace Sequence: CGTGTAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTTTTCTCTTGGCTTGGTTCAGCATCTAACAACGCAGAGCGAATTCCCAACTTATTCAGCTCTTCTACAAGGTCTCCATTCTGATGCATTTGAAGTAGGATATCACAGCCTCCCACAAATTCACCATTAAAGTAGACCTGAGGTATGGTGGGCCAGTTTGAATAATTCTTTATCCCCTGCCTCAGGTCCTGGTCCTCCAGCACATTATAGGCCGCATAGTCGTTCACTCCATGCATGCGGAGTATCTGCACCACCGCGTTGCTAAAGCCGCACATGGGTTGGGCCGGGGTGCCCTTGATGAACACCACCACTTTGTCCTTCTTCACCAAGCCGTCTAAGTGCTCGGGCGATACGCTGTCTGAACTAAGCCATCGCAGGACGGATAAGGAGCCACAGGCCTGCGGAGTCCTAGCGCTCCCTCGCAAAACAGCCGCGGAGACTTTGCTCAAACACCAACTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCACTTTGTTGCCACGAACAGGCCACTATCAGTCCAAATAAAATCATTATTTTGGGCCCCGAGCTAAAAACTGGAACATCATTTTCAACGCCCGTGAACTGGGATTTTCCGTGGCAGCTTCTGCCCCGGTTTCCCAAAATCTCTTAAATGTTTAAAGGTGTGNCNTTTCAGAGAAAAAAAGAAGCAAGAACTCTAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTTTCTCTTGGCTTGGTTC