ORFeome > glul-prov ORF1 – XORFeome v1.0

glul-prov ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: unnamed
Gene ID: 990058
Gene Page ID: 990052
ORF Xenbase ID: 17277285

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054153
Original XGC clone length: 1122

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: D03

Sequences - 5ʹ (forward) EST

Accession: JZ839156
dbEST ID: 79656858
Trimmed Sequence: ATGGCAACCTCCGCCAGTGCTCAGTTGAGTAAGGCCATAAAGCAGATGTATCTGGAACTGCCGCAGGGAGATAAGGTGCAGGCTATGTACATCTGGATTGATGGGACCGGGGAGGGTCTTCGCTGCAAGACTCGCACTCTGGACAGTGAACCCAAGACCATAGAAGATCTGCCCGAATGGAACTTCGATGGATCTAGCACACACCAATCTGAGGGATCCAACAGTGACATGTACCTGATTCCAGTTGCAATGTTTAGAGATCCTTTTCGAAGGGATCCCAACAAGCTGGTGCTCTGCGAGGTGCTAAAATACAACCGAAAAACTGCAGAAACAAACCTACGTCATACATGTAACCAGATAATGGACATGGTGGGCAATGAGCATCCATGGTTTGGCATGGAACAGGAATATACATTGCTGGGTATGGATGGACACCCTTTTGGCTGGCCATCAAATGGCTTCCCAGGACCTCAAGGCCCCTATTACTGTGGAGTGGGTGCAAATAAGGCATATGGTCGAGATATTGTGGAGGCTCATTATCGGGCTTGTCTATATGCTGGTGTGAAAATTGCAGGAACTAACGCAAAAATTATGCCAACACAGTGGGAGTTCCCAATTGGAACATGTGAAGGAATAGATATGGGGAGATCACCTTTGGAATGCTCGATTTATACTGCATAAAGTGTGTGAAGAATTTTGGGATCATTGTTTCCTTTTACCCAAAGGCCCACCCCTGGAAAACTGGGAATGGGACCTGGGAAGGCCGAACCAATTTTTTCACACAAAAATCACAAT
Full Trace Sequence: CCTCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAACCTCCGCCAGTGCTCAGTTGAGTAAGGCCATAAAGCAGATGTATCTGGAACTGCCGCAGGGAGATAAGGTGCAGGCTATGTACATCTGGATTGATGGGACCGGGGAGGGTCTTCGCTGCAAGACTCGCACTCTGGACAGTGAACCCAAGACCATAGAAGATCTGCCCGAATGGAACTTCGATGGATCTAGCACACACCAATCTGAGGGATCCAACAGTGACATGTACCTGATTCCAGTTGCAATGTTTAGAGATCCTTTTCGAAGGGATCCCAACAAGCTGGTGCTCTGCGAGGTGCTAAAATACAACCGAAAAACTGCAGAAACAAACCTACGTCATACATGTAACCAGATAATGGACATGGTGGGCAATGAGCATCCATGGTTTGGCATGGAACAGGAATATACATTGCTGGGTATGGATGGACACCCTTTTGGCTGGCCATCAAATGGCTTCCCAGGACCTCAAGGCCCCTATTACTGTGGAGTGGGTGCAAATAAGGCATATGGTCGAGATATTGTGGAGGCTCATTATCGGGCTTGTCTATATGCTGGTGTGAAAATTGCAGGAACTAACGCAAAAATTATGCCAACACAGTGGGAGTTCCCAATTGGAACATGTGAAGGAATAGATATGGGGAGATCACCTTTGGAATGCTCGATTTATACTGCATAAAGTGTGTGAAGAATTTTGGGATCATTGTTTCCTTTTACCCAAAGGCCCACCCCTGGAAAACTGGGAATGGGACCTGGGAAGGCCGAACCAATTTTTTCACACAAAAATCACAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAACCTCCGCCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839155
dbEST ID: 79656857
Trimmed Sequence: GTTCTTGTATTCAAGAGGTTCATCTCCAGTTTCATTCAGCAGGCAGGTCCTGATGACAGCCTCTGTCACGGCATAAGGATCACAGTTGGCTGATGGACGACGATCTTCAAAGTAGCCTTTCTTCTCCTGACCTACAAGGCGTGGAATGCGGATACTTGCACCACGGTTTGCCACTCCTGCTGAGAACTCATGGATGCTGGATGTCTCATGGAAACCTGTGAGACGACGGGCATTGTCTTTACCACCTCTTGGATCATACATCCTAATGTGATACTCATGACGTTTGCTTAAACGTTCAATGGATTCTTCTATGTGCTTAAGGCCTCCTTCTTCACGCATTGATTTTGTGCTGAAATTGGTATGACATCCAGCTCCATTCCAGTTTCCAGTGATGGGCTTTGGGTCAAATGAAACAATGATCCCAAAATCCTCACACACTCTATGCAGTATAAATCGAGCAATCCAAAGGTGATCTCCCATATCTATTCCTTCACATGTTCCAATTTGGAACTCCCACTGTGCTGGCATAACTTCTGCGTTAGTTCCTGCAATTTTCACACCAGCATATAGACAAGCCCGAATATGAGCCTCCACAATATCTCGACCATATGCCCTAATTGCACCCACTCCACCGTAATAAGGGCCCTGAAGGTCCTGGGAAAACCATTTTAATGGCCAACCCAAAAAGGGTGTCCCATCCAATACCCCAGACAATGTTAAAATCCCCTTGTTCCCATGGCCAAAAACAAGGGGAAGGC
Full Trace Sequence: GACGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTCTTGTATTCAAGAGGTTCATCTCCAGTTTCATTCAGCAGGCAGGTCCTGATGACAGCCTCTGTCACGGCATAAGGATCACAGTTGGCTGATGGACGACGATCTTCAAAGTAGCCTTTCTTCTCCTGACCTACAAGGCGTGGAATGCGGATACTTGCACCACGGTTTGCCACTCCTGCTGAGAACTCATGGATGCTGGATGTCTCATGGAAACCTGTGAGACGACGGGCATTGTCTTTACCACCTCTTGGATCATACATCCTAATGTGATACTCATGACGTTTGCTTAAACGTTCAATGGATTCTTCTATGTGCTTAAGGCCTCCTTCTTCACGCATTGATTTTGTGCTGAAATTGGTATGACATCCAGCTCCATTCCAGTTTCCAGTGATGGGCTTTGGGTCAAATGAAACAATGATCCCAAAATCCTCACACACTCTATGCAGTATAAATCGAGCAATCCAAAGGTGATCTCCCATATCTATTCCTTCACATGTTCCAATTTGGAACTCCCACTGTGCTGGCATAACTTCTGCGTTAGTTCCTGCAATTTTCACACCAGCATATAGACAAGCCCGAATATGAGCCTCCACAATATCTCGACCATATGCCCTAATTGCACCCACTCCACCGTAATAAGGGCCCTGAAGGTCCTGGGAAAACCATTTTAATGGCCAACCCAAAAAGGGTGTCCCATCCAATACCCCAGACAATGTTAAAATCCCCTTGTTCCCATGGCCAAAAACAAGGGGAAGGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTCTTGTATTCAAGAGGTTCATC