ORFeome > gmfb ORF1 – XORFeome v1.0

gmfb ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: gmfb
Gene ID: 6077283
Gene Page ID: 6077245
ORF Xenbase ID: 17277303

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084826
Original XGC clone length: 429

Human orthology & disease relationships

NCBI Entrez ID: 2764
Ensembl gene IDs: ENSG00000197045
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101600,104300,105120,108120,115200,123500,125853,131950,145980,182290,211980,215600,226650,226670,600652,603278,607841,609285

Library Location

Plate ID: GDExl11005
Well Location: F12

Sequences - 5ʹ (forward) EST

Accession: JZ840006
dbEST ID: 79657708
Trimmed Sequence: ATGAGTGAGTCTCTGGTTGTTTGTGATGTGGATGCAGAACTTGTGGAGAAGTTAAAAAAGTTTCGCTTTCGAAAAGAAACCAACAATGCTGCTATTATTATGAAAATAGACAAAGATCGGCGATTAGTGGTTCTGGAGGAGGAACATGAGGATATATCCCCCGATGAGCTGAAAGATGAACTTCCCGAGAGGCAACCAAGATTTATAGTATACAGTTACAAGTACCAACATGATGATGGCAGAGTTTCTTATCCATTGTGCTTTATCTTCTCCAGCCCCTTAGGATGTAAACCAGAACAGCAGATGATGTATGCAGGAAGCAAAAATAAGCTAGTTCAGACGGCTGAACTCACAAAGGTTTTTGAAATCAGAAACACTGAAGACCTCACTGAAGAATGGCTAACTGAGAAACTTGGCTTCTTCCATTT
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTGAGTCTCTGGTTGTTTGTGATGTGGATGCAGAACTTGTGGAGAAGTTAAAAAAGTTTCGCTTTCGAAAAGAAACCAACAATGCTGCTATTATTATGAAAATAGACAAAGATCGGCGATTAGTGGTTCTGGAGGAGGAACATGAGGATATATCCCCCGATGAGCTGAAAGATGAACTTCCCGAGAGGCAACCAAGATTTATAGTATACAGTTACAAGTACCAACATGATGATGGCAGAGTTTCTTATCCATTGTGCTTTATCTTCTCCAGCCCCTTAGGATGTAAACCAGAACAGCAGATGATGTATGCAGGAAGCAAAAATAAGCTAGTTCAGACGGCTGAACTCACAAAGGTTTTTGAAATCAGAAACACTGAAGACCTCACTGAAGAATGGCTAACTGAGAAACTTGGCTTCTTCCATTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGAAATCCCCTATAGTGAGTTGTATTACATGGTCCTAACTGTTTCCTCAAAAAAAAAAACAATGTCTCAAAATCACGAATGCTACAAACCAGGAGAAAAAATCCCAACTTCTCCCTCCAAAGGGGCGGGGGGGTCTCACTGGGGTGTGAAAAAAAAAAAAAACAAGGAAAAAACACGCGCGGCGCTACCTGATAGGGGAAAGGGGCCGCGCGCCAATGGATACAAACCACCTAAAACCCCCCGGAGGGGAAGAAGAGAGGGGGGGGTGGAGGTATGGGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTGAGTCTCTGGTTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ840005
dbEST ID: 79657707
Trimmed Sequence: ATGGAAGAAGCCAAGTTTCTCAGTTAGCCATTCTTCAGTGAGGTCTTCAGTGTTTCTGATTTCAAAAACCTTTGTGAGTTCAGCCGTCTGAACTAGCTTATTTTTGCTTCCTGCATACATCATCTGCTGTTCTGGTTTACATCCTAAGGGGCTGGAGAAGATAAAGCACAATGGATAAGAAACTCTGCCATCATCATGTTGGTACTTGTAACTGTATACTATAAATCTTGGTTGCCTCTCGGGAAGTTCATCTTTCAGCTCATCGGGGGATATATCCTCATGTTCCTCCTCCAGAACCACTAATCGCCGATCTTTGTCTATTTTCATAATAATAGCAGCATTGTTGGTTTCTTTTCGAAAGCGAAACTTTTTTAACTTCTCCACAAGTTCTGCATCCACATCACAAACAACCAGAGACTCCTTCATGG
Full Trace Sequence: AAACAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATGGAAGAAGCCAAGTTTCTCAGTTAGCCATTCTTCAGTGAGGTCTTCAGTGTTTCTGATTTCAAAAACCTTTGTGAGTTCAGCCGTCTGAACTAGCTTATTTTTGCTTCCTGCATACATCATCTGCTGTTCTGGTTTACATCCTAAGGGGCTGGAGAAGATAAAGCACAATGGATAAGAAACTCTGCCATCATCATGTTGGTACTTGTAACTGTATACTATAAATCTTGGTTGCCTCTCGGGAAGTTCATCTTTCAGCTCATCGGGGGATATATCCTCATGTTCCTCCTCCAGAACCACTAATCGCCGATCTTTGTCTATTTTCATAATAATAGCAGCATTGTTGGTTTCTTTTCGAAAGCGAAACTTTTTTAACTTCTCCACAAGTTCTGCATCCACATCACAAACAACCAGAGACTCCTTCATGGTGCCAACTTTTTTGTACAAAGCTCGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACCAAACAGTCACTATCAGTCAAAATAAATCATTATTTGGGGCCCGAAAAAAAAATAATCGACGATTAACATGTCATTCGGAGGAGCAGGGATCAATGGCCCGACGTGCCGCCGCAAAAGTGGCGGTGGTGTCACCTTGTGTTAAAAAGGAAGGCACACACAAATGGAAAAACCGGGTCGGCGCGAGATAGGATGGGAAACAGGCAACGCCCGCGCNATTGGGCAAAACCTGGGCGAGACGCCGGGGGGGGGAGGGGGCAGGTGGGGTTTNGTTGGTGTGTGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGGAAGAAGCCAAGTTTCTCAGT