ORFeome > gmppb ORF2 – XORFeome v1.0

gmppb ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gmppb
Gene ID: 6255238
Gene Page ID: 922649
ORF Xenbase ID: 17277345

ORF full-length analysis tests

Full-Length confidence: medium
Original XGC clone accession: BC129595
Original XGC clone length: 1083

Human orthology & disease relationships

NCBI Entrez ID: 29925
Ensembl gene IDs: ENSG00000173540
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 102900,103050,180105,211900,212065,219500,230800,230900,231000,231005,242860,250940,266200,268000,312170,400042,602579,605850,607091,608013,608688,610015

Library Location

Plate ID: GDExl11091
Well Location: F04

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAACACTAATTCCCCTTGGTGGAAATGGAACCAAGCTGCCGCCCTTAACACTGAATGTGCCCAAACCATTAATAAACTTCCGTAACAAACCCATCCCCCTGCACCAAGTGGAAGCCCTGGTAAAGGCTGGAATCCCACATGTGAACCCTGCTGTCCACCACCTGTCCAAAATGTTAAAAAAAGAAATGAAAGAACAAGAAAAAAAGCTTGGTAACCCAATCCCAATGTCCCATGAAAAAGAACCCTTGGGTACCGCTGGTCCTTTAACCCCGGCAAGGGAACTACTGACAAAAAACTCCGAACCATTCCTTGTCCCTAACAATGAAGTCCTTTGTGACTTTCCTTTCCAAGAAATGGTGAAAATCCATAAACACCACCGGAAAAAAAGAACCATCCTGGTAACCAAAGTAAAAGAACCCTCCAAATAAGGAATTGTTATATATGAAGCAAAAACAAGGCGAATCCAACCCCTTGTGGAAAAACCACCGGTGTTTGGGTCCGAAAAAAACCACTCACAGAATGGCCTCCTCCCCCCCGCCGGGCCTGAACGGAATCAACTACGCCCCAACCCCAAAAAAAAGGAAAAATTCCCCGTTATGGCTCAAGGAGGGCACATATTTTCATTGGAGCCTCAAGGGGTTCCGAAAGGGAATAGATCCACCCAAAAAACTCCCGACCCACAAGTGTTGGTCCCCCCCATCTCGGTCAAAACAAAGACCCCCAAACCCGCTTCCGAGTTTGAACCTGAAATCCAAGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAAGCACTAATTCTCGTTGG

Sequences - 3ʹ (reverse) EST

Accession: JZ838713
dbEST ID: 79656415
Trimmed Sequence: CATGATTATCCGTGGTTCTGGCACAGACTCAGAGATGCACTTGTGTGGCAGGACGTTGGCTCCATTTAGGTAAAGTTCATCATTAACAATGACGTCTTCCCCCAGCACAGTCACATTCTCCATGCGCACCCACTGTCCTACTGATGAGCTCCAACCAACAATGGAGGACTGAAGCCAGGAATGGGAGTGCAGCCTGGAGCCTTTCATGATAGAGCAGCGCTTGATCCGCACTCCGTCCTCTACAGTCACGCCAGGGCCAATAGTCACATTAGGGCCAATGCTGCAGTTCTGACCAATCTTCGCTGTGGGATCCACCAGAACATTCCCAGTGAATCCAGGTCCAACATGAAGCCGCTCTGGGTGCTTGTGTCTGACAGACTGGAGGTACATACACATGCCGGTCAGGAAGTCTTTAGGCTGACCAATGTCCATCCAGAACCCTTGCAGCTCCNATGCAAATAACTGCCCCTCCTGAGCCATAACAGGGAAAATCTCCTTTTCTATGGAGGTTGGGCGTAGCTGAATACGATCCAGCACAGCCGGGGGAGAAGATGTACAGTCCTGAGTTGATCTTGTTGGACACAAACACCTGTGGCCTCTCCACAAAACGTTGGATTCGCCCCGATTCTGCTTCATATATAACAACTCCATAATTTAAAAGGTTTCTCTACCTTTGGTTACCACCAATGGTTCCTTTCTTTTCCCGTGGGGGTTTAATGGAAATCTCACCCCAAACCCCCCCAAAAGGAAAAAATCTAAAAA
Full Trace Sequence: AAACAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATGATTATCCGTGGTTCTGGCACAGACTCAGAGATGCACTTGTGTGGCAGGACGTTGGCTCCATTTAGGTAAAGTTCATCATTAACAATGACGTCTTCCCCCAGCACAGTCACATTCTCCATGCGCACCCACTGTCCTACTGATGAGCTCCAACCAACAATGGAGGACTGAAGCCAGGAATGGGAGTGCAGCCTGGAGCCTTTCATGATAGAGCAGCGCTTGATCCGCACTCCGTCCTCTACAGTCACGCCAGGGCCAATAGTCACATTAGGGCCAATGCTGCAGTTCTGACCAATCTTCGCTGTGGGATCCACCAGAACATTCCCAGTGAATCCAGGTCCAACATGAAGCCGCTCTGGGTGCTTGTGTCTGACAGACTGGAGGTACATACACATGCCGGTCAGGAAGTCTTTAGGCTGACCAATGTCCATCCAGAACCCTTGCAGCTCCNATGCAAATAACTGCCCCTCCTGAGCCATAACAGGGAAAATCTCCTTTTCTATGGAGGTTGGGCGTAGCTGAATACGATCCAGCACAGCCGGGGGAGAAGATGTACAGTCCTGAGTTGATCTTGTTGGACACAAACACCTGTGGCCTCTCCACAAAACGTTGGATTCGCCCCGATTCTGCTTCATATATAACAACTCCATAATTTAAAAGGTTTCTCTACCTTTGGTTACCACCAATGGTTCCTTTCTTTTCCCGTGGGGGTTTAATGGAAATCTCACCCCAAACCCCCCCAAAAGGAAAAAATCTAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATGATTATCCGTGGTTCTG