ORFeome > gna11 ORF1 – XORFeome v1.0

gna11 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gna11
Gene ID: 944503
Gene Page ID: 944496
ORF Xenbase ID: 17277357

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC042284
Original XGC clone length: 1080

Human orthology & disease relationships

NCBI Entrez ID: 2767
Ensembl gene IDs: ENSG00000088256
Directly associated (OMIM) disease MIM numbers: 145981,615361
Indirectly associated (Lage, et al.) disease MIM numbers: 102200,103580,121850,137800,142623,148700,153480,158350,162210,166350,174800,176410,176807,176920,188050,193520,207800,207900,214450,215700,256710,276950,277580,300555,303600,309000,311250,600155,600501,608089,609227

Library Location

Plate ID: GDExl11017
Well Location: B01

Sequences - 5ʹ (forward) EST

Accession: JZ824360
dbEST ID: 79642062
Trimmed Sequence: ATGACTCTAGATTCAATGATGGCCTGCTGCCTGAGCGAGGAGGTAAAGGAATCCAAGAGAATCAACGCGGAGATCGAGAAGCAGCTGAGGAGGGACAAGAAAGACTCTCGGCGGGAGCTCAAATTGCTTTTGCTCGGTACTGGAGAGAGTGGAAAAAGCACATTCATTAAACAGATGAGGATCATCCATGGCTCAGGTTATTCTGAAGAGGACAAGAGGGGATTCACCAAGCTAGTTTTTCAGAATATCTTCACTGCCATGCAGTCTATGATAAGAGCCATGGAAACACTGAAAATTCTCTACAAGTTTGAACAGAACAAGGCCAATGCTCAAATTGTGCGAGAAGTGGATGTAGAGAAAGTATGTACCTTTGAACAGCCATATGTGAATGCAGTCAAAAACCTGTGGAGTGACCCTGGGATTCAGGAGTGCTATGATAGACGGCGGGAGTACCAACTGTCAGATTCTACCAAGTATTACCTGACAGATGTGGACCGGATTTCAAAACCCGGCTACCTGCCCACACAACAAGATGTGCTACGTGTAAGAGTGCCAACAACGGGTATAATAGAGTACCCTTTTGATTTGGAGAACTCATCTTCAGGATGGTAGACGTTGGTGGTCAGAGGTCTGAACGAAGGANATGGATTCATTGCTTTGAGAATGCACTTCCATCATGTTCCTCGTAGCTCTTAGTGATATGACCNAGTTTCTTGTGGNAGTCTGATATGAGAATCGGGAGGGGAGGAAATAGGGCACTGTTCAGGACATAATCCCGTAACCCTGGGTTCCAAAATCCCCCTGTCCATCTGTTCTTAAAAAAAAAGGGACTGCCGGAAAAAAGAAA
Full Trace Sequence: TAATGATTTTTATTTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTCTAGATTCAATGATGGCCTGCTGCCTGAGCGAGGAGGTAAAGGAATCCAAGAGAATCAACGCGGAGATCGAGAAGCAGCTGAGGAGGGACAAGAAAGACTCTCGGCGGGAGCTCAAATTGCTTTTGCTCGGTACTGGAGAGAGTGGAAAAAGCACATTCATTAAACAGATGAGGATCATCCATGGCTCAGGTTATTCTGAAGAGGACAAGAGGGGATTCACCAAGCTAGTTTTTCAGAATATCTTCACTGCCATGCAGTCTATGATAAGAGCCATGGAAACACTGAAAATTCTCTACAAGTTTGAACAGAACAAGGCCAATGCTCAAATTGTGCGAGAAGTGGATGTAGAGAAAGTATGTACCTTTGAACAGCCATATGTGAATGCAGTCAAAAACCTGTGGAGTGACCCTGGGATTCAGGAGTGCTATGATAGACGGCGGGAGTACCAACTGTCAGATTCTACCAAGTATTACCTGACAGATGTGGACCGGATTTCAAAACCCGGCTACCTGCCCACACAACAAGATGTGCTACGTGTAAGAGTGCCAACAACGGGTATAATAGAGTACCCTTTTGATTTGGAGAACTCATCTTCAGGATGGTAGACGTTGGTGGTCAGAGGTCTGAACGAAGGANATGGATTCATTGCTTTGAGAATGCACTTCCATCATGTTCCTCGTAGCTCTTAGTGATATGACCNAGTTTCTTGTGGNAGTCTGATATGAGAATCGGGAGGGGAGGAAATAGGGCACTGTTCAGGACATAATCCCGTAACCCTGGGTTCCAAAATCCCCCTGTCCATCTGTTCTTAAAAAAAAAGGGACTGCCGGAAAAAAGAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTCTAGATTCAATGATGGC

Sequences - 3ʹ (reverse) EST

Accession: JZ829719
dbEST ID: 79647421
Trimmed Sequence: CACCAGGTTGTACTCTTTAAGGTTGTGCTGTAGTATGGTGTCTTTGACAGCAGCGAAGACAAAGCGTATGTTCTCGGTATCAGTGGCACAGGTGAAGTGCGAATAGATGATCTTATCACTGTCAGGATTCAGGTCCACAAACATCTTCAAAATGAATTCACGAGCTGTTGCAGCATCCCGTTGAGGGCCATCAAATTCAGGAAAATAGTCTACGAGGTGGGAATACATGATCTTATCTTCCAGCAGATCCTTCTTATTTAAGAACAGAATGACAGAGGAATTTTGGAACCATGGGTACGTGATTATGGTCCTGAACAGTGCCTTACTTTCCTCCATCCGATTCTCATTATCAGACTCCACAAGAACTTGGTCATATTCACTAAGAGCTACGAGGAACATGATGGAAGTGACATTCTCAAAGCAATGAATCCATTTCCTTCGTTCAGACCTCTGACCACCAACGTCTACCATCCTGAAGATGATGTTCTCCAAATCAAAAGGGTACTCTATTATACCCGTTGTTGGCACTCTTACACGTAGCACATCTTGTTGTGTGGGCAGGTAGCCGGGTTTTGAAATCCGGGTCACATCTGTCAGGTAATACTTGGGTAGAATCTGACAGGTTGGTACTCCCCCCCGTCTATCAAAGCACCTCCTGAAATCCAAGGTCCACTCCACAGGTTTTTTGACTGGATTTCCCCATATGGCTTGTTCAAAGGGTACATTCCTTTTCCTCTACATTCCCCTTTCTTCCCCAAAAATTTTGAA
Full Trace Sequence: TGACAGGGAACAGCTATGACCATGTAATACGACTCACTATANGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACCAGGTTGTACTCTTTAAGGTTGTGCTGTAGTATGGTGTCTTTGACAGCAGCGAAGACAAAGCGTATGTTCTCGGTATCAGTGGCACAGGTGAAGTGCGAATAGATGATCTTATCACTGTCAGGATTCAGGTCCACAAACATCTTCAAAATGAATTCACGAGCTGTTGCAGCATCCCGTTGAGGGCCATCAAATTCAGGAAAATAGTCTACGAGGTGGGAATACATGATCTTATCTTCCAGCAGATCCTTCTTATTTAAGAACAGAATGACAGAGGAATTTTGGAACCATGGGTACGTGATTATGGTCCTGAACAGTGCCTTACTTTCCTCCATCCGATTCTCATTATCAGACTCCACAAGAACTTGGTCATATTCACTAAGAGCTACGAGGAACATGATGGAAGTGACATTCTCAAAGCAATGAATCCATTTCCTTCGTTCAGACCTCTGACCACCAACGTCTACCATCCTGAAGATGATGTTCTCCAAATCAAAAGGGTACTCTATTATACCCGTTGTTGGCACTCTTACACGTAGCACATCTTGTTGTGTGGGCAGGTAGCCGGGTTTTGAAATCCGGGTCACATCTGTCAGGTAATACTTGGGTAGAATCTGACAGGTTGGTACTCCCCCCCGTCTATCAAAGCACCTCCTGAAATCCAAGGTCCACTCCACAGGTTTTTTGACTGGATTTCCCCATATGGCTTGTTCAAAGGGTACATTCCTTTTCCTCTACATTCCCCTTTCTTCCCCAAAAATTTTGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACCAGGTTGTACTCTTTAAGGTT