ORFeome > gna15 ORF1 – XORFeome v1.0

gna15 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gna15
Gene ID: 1011754
Gene Page ID: 1011752
ORF Xenbase ID: 17277381

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129776
Original XGC clone length: 759

Human orthology & disease relationships

NCBI Entrez ID: 2769
Ensembl gene IDs: ENSG00000060558
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 102200,103580,121850,137800,142623,148700,153480,158350,162210,166350,174800,176410,176807,176920,188050,193520,207800,207900,214450,215700,256710,276950,277580,300555,303600,309000,311250,600155,600501,608089,609227

Library Location

Plate ID: GDExl11090
Well Location: E12

Sequences - 5ʹ (forward) EST

Accession: JZ838629
dbEST ID: 79656331
Trimmed Sequence: ATGCCTTGGTGGTGCTGCGGCTGTTTCTTCCCTCCTTGTATCTCTGAGGAGGAGATTACTGCTCTGACTGTGAACAGAGAGATTGAAAGAATTCTTAAACTCCAGAAGGAGAGAAGCCGTGCTGAGATAAAACTCCTGCTTCTGGGAACAGGAGAGAGTGGAAAGAGTACATTCATAAAGCAGATGAGGATCATTCATGGAACAGGATTCTCAGAGCAAGAGAGAAAGTTTTATGCCCGGCTGGTACACCAAAATATTGTCACCTGTGCACAGTCCCTAGTTTGGGCCATGGAGACTTTGCAAGTGCCTTACACCATACAAAACAATCAGCTAAATGGAAGCATGATCAGAGAATTATATGCATTTAGAATCCAGAGGATTGAGGAACCACATGTTAAGGCCATTAGCAAATTATGGAGTGATACTGAAATTCAAAGATGCTATGATAGGAGGAGGGAATTTCATCTACTAGACTCAACAGACTACTATTTGTCTAATTTAGAACGTCTCACACAGGAAGGGTACCAAACCACAAATGAGGACGTTCTACAGAATCCGAATGCCATCGACAGAGCATGCATGAGTACTGCTTTCTTTGTGGAAAATATAGACCCTTAAAGTGGTAGATAGTCGGTGGAAAGAAAAACAAAATCGGAGGAAAGTGAATTCAATTCTTTACGAAAAAGTTTGTTGGCTCCTTAGTTTGTTTTGGGATTCTGATAGGTGAATTATGAACAAGAAATTTTAGAGAAAAGAGTGCCGGGAGGAGGTTGAGAAGGCGCCGAGTGGGCCAGATTGTTTGTTTTTATATATAAATT
Full Trace Sequence: CTCGGGGCCCACATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTTGGTGGTGCTGCGGCTGTTTCTTCCCTCCTTGTATCTCTGAGGAGGAGATTACTGCTCTGACTGTGAACAGAGAGATTGAAAGAATTCTTAAACTCCAGAAGGAGAGAAGCCGTGCTGAGATAAAACTCCTGCTTCTGGGAACAGGAGAGAGTGGAAAGAGTACATTCATAAAGCAGATGAGGATCATTCATGGAACAGGATTCTCAGAGCAAGAGAGAAAGTTTTATGCCCGGCTGGTACACCAAAATATTGTCACCTGTGCACAGTCCCTAGTTTGGGCCATGGAGACTTTGCAAGTGCCTTACACCATACAAAACAATCAGCTAAATGGAAGCATGATCAGAGAATTATATGCATTTAGAATCCAGAGGATTGAGGAACCACATGTTAAGGCCATTAGCAAATTATGGAGTGATACTGAAATTCAAAGATGCTATGATAGGAGGAGGGAATTTCATCTACTAGACTCAACAGACTACTATTTGTCTAATTTAGAACGTCTCACACAGGAAGGGTACCAAACCACAAATGAGGACGTTCTACAGAATCCGAATGCCATCGACAGAGCATGCATGAGTACTGCTTTCTTTGTGGAAAATATAGACCCTTAAAGTGGTAGATAGTCGGTGGAAAGAAAAACAAAATCGGAGGAAAGTGAATTCAATTCTTTACGAAAAAGTTTGTTGGCTCCTTAGTTTGTTTTGGGATTCTGATAGGTGAATTATGAACAAGAAATTTTAGAGAAAAGAGTGCCGGGAGGAGGTTGAGAAGGCGCCGAGTGGGCCAGATTGTTTGTTTTTATATATAAATT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTTGGTGGTGCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ838628
dbEST ID: 79656330
Trimmed Sequence: TGGGCTTCTCACTTCATGGGAGTTCTCTTCCAATTTCTGGTCATATTCACTCAGAGATGCCAAATAAATGAGAGCAGACACATTTTCGAAAGAGTGAATCCACTTCCTCCGCTCTGATTTCTGTCCACCGACATCGACCATTCTAAGGTCCATATTCTCCACAGAGAAGCAGTACTCATTGATGCCTGTGGTTGGCATTCGGATTCTGAGAATGTCCTCATCTGTGGGTTGGTACCCATCCTGTGTGAGACGCTCCAAATTAGACAAATAGTAGTTTGTTGAGTCTAGTAGCTGAAATTCCCTCCTCCTCTCATAGCATCTTTGAATTCCAGTATCACTCCATAATTTGCTAATGGCCTTAACATGTGGTTCCTCAATCCTCTGGATTCTAAATGCATATAATTCTCTGATCATGCTTCCATTTAGCTGATTGTTTTGTATGGTGTAAGGCACTTGCAAAGTCTCCATGGCCCAGACTAAGGACTGTGCACAGGTGACAATATTTTGGTGTACCAGCCGGGCATAAAACTTTCTCTCTTGCTCTGAGAATCCTGTTCCATGAATGATCCTCATCTGCTTTATGAATGTACTCCTTCCACTCTCTCCTGTTCCCGAAAGCGAGAATTTTAACCTAGCCCGGCATCTCTCCCTCGGGAAATTTAGGAATTCTTTTATTCTCTTCTTGTTCCATTCCAAAGCGGTATATCTCCTCCCTCAAACACTCCAAGAAAGGAAAGAAAAAGAGCGGAAAGACCCAACCAACGACCTTGGATGGCCGAAC
Full Trace Sequence: GGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGGGCTTCTCACTTCATGGGAGTTCTCTTCCAATTTCTGGTCATATTCACTCAGAGATGCCAAATAAATGAGAGCAGACACATTTTCGAAAGAGTGAATCCACTTCCTCCGCTCTGATTTCTGTCCACCGACATCGACCATTCTAAGGTCCATATTCTCCACAGAGAAGCAGTACTCATTGATGCCTGTGGTTGGCATTCGGATTCTGAGAATGTCCTCATCTGTGGGTTGGTACCCATCCTGTGTGAGACGCTCCAAATTAGACAAATAGTAGTTTGTTGAGTCTAGTAGCTGAAATTCCCTCCTCCTCTCATAGCATCTTTGAATTCCAGTATCACTCCATAATTTGCTAATGGCCTTAACATGTGGTTCCTCAATCCTCTGGATTCTAAATGCATATAATTCTCTGATCATGCTTCCATTTAGCTGATTGTTTTGTATGGTGTAAGGCACTTGCAAAGTCTCCATGGCCCAGACTAAGGACTGTGCACAGGTGACAATATTTTGGTGTACCAGCCGGGCATAAAACTTTCTCTCTTGCTCTGAGAATCCTGTTCCATGAATGATCCTCATCTGCTTTATGAATGTACTCCTTCCACTCTCTCCTGTTCCCGAAAGCGAGAATTTTAACCTAGCCCGGCATCTCTCCCTCGGGAAATTTAGGAATTCTTTTATTCTCTTCTTGTTCCATTCCAAAGCGGTATATCTCCTCCCTCAAACACTCCAAGAAAGGAAAGAAAAAGAGCGGAAAGACCCAACCAACGACCTTGGATGGCCGAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGGGCTTCTCACTTCATGGGAGTT