ORFeome > gng2 ORF1 – XORFeome v1.0

gng2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: gng2
Gene ID: 961285
Gene Page ID: 961281
ORF Xenbase ID: 17277495

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078557
Original XGC clone length: 216

Human orthology & disease relationships

NCBI Entrez ID: 54331
Ensembl gene IDs: ENSG00000186469
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 102200,103580,166350,174800

Library Location

Plate ID: GDExl11005
Well Location: B04

Sequences - 5ʹ (forward) EST

Accession: JZ839884
dbEST ID: 79657586
Trimmed Sequence: ATGGCCAGCAATAACACAGCCAGTATAGCTCAAGCCAGAAAGCTGGTGGAACAGCTAAAAATGGAAGCCAACATCGACAGAATAAAGGTATCGAAAGCGGCAGCTGACTTGATGGCTTACTGTGAAGCCCACGCCAAGGAAGACCCACTTCTCTCCCCAGTGCCTGCATCAGAAAACCCATTTAGAGAGAAGAAGTTTTTCTGTGCCATCCTGTT
Full Trace Sequence: TCGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCAGCAATAACACAGCCAGTATAGCTCAAGCCAGAAAGCTGGTGGAACAGCTAAAAATGGAAGCCAACATCGACAGAATAAAGGTATCGAAAGCGGCAGCTGACTTGATGGCTTACTGTGAAGCCCACGCCAAGGAAGACCCACTTCTCTCCCCAGTGCCTGCATCAGAAAACCCATTTAGAGAGAAGAAGTTTTTCTGTGCCATCCTGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCAAAAAAAAAAAAAAAAAACATAATATAATGAAATTTTGGGAAAAACGGGGGGGAAAGGGGCCAATTTTCTTCCCCCCAGGGGGGGGGGGGGGGGTTTTTGTTGATTTGGGAGGGGGGCCGGGCGAACCCAACAGCCGGACGGGGGGAGGTCGGGTTGCGGGGGAACCTCGCCCCGGCCCGCCCCCAAAACTAAAGAAAAAACGGGGGGGGGGCGGGGGGGGGGGGTTAAAATTTTTTAAAAAATTTTTTTGTGGATAACCGACCAAGCCCCCCTTCCCCGGGGCCGGGCATACCCGGTTTGTGTGGGGGGAATAATTTAATAGCCCAGACACCACAAAACAACGGCGGCGGGTCTCCGCCGGGGTGGGTGTAATGGGTGGGAGTTGTTGAGGAGAACCACACCAACTATCTTCATAACACAAGAGAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCAGCAATAACACAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839883
dbEST ID: 79657585
Trimmed Sequence: CAGGATGGCACAGAAAAACTTCTTCTCTCTAAATGGGTTTTCTGATGCAGGCACTGGGGAGAGAAGTGGGTCTTCCTTGGCGTGGGCTTCACAGTAAGCCATCAAGTCAGCTGCCGCTTTCAATACCTTTATTCTGTCGATGTTGGCTTCCATTTTTAGCTGTTCCACCAGCTTTCTGGCTTGAGCTATACTGGCTGTGTTATTGCTGGCCATGG
Full Trace Sequence: GAAACAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGGATGGCACAGAAAAACTTCTTCTCTCTAAATGGGTTTTCTGATGCAGGCACTGGGGAGAGAAGTGGGTCTTCCTTGGCGTGGGCTTCACAGTAAGCCATCAAGTCAGCTGCCGCTTTCAATACCTTTATTCTGTCGATGTTGGCTTCCATTTTTAGCTGTTCCACCAGCTTTCTGGCTTGAGCTATACTGGCTGTGTTATTGCTGGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACACGTCACTATCAGTCAAAATAAAATCATTATTTGCCGCCCGAGCTTAAGACCTGGCCNTCAAAAAAAAAAAACAAAAAAAATTATTTACAAGGCCACCGAGCGGCCGGGGGCGAAAGAACGCATCTCCTTCTTCCAAGAGGGGGGTGGGGGGTGTTACTCTTGTATCGGGGGGAGGGCGCACCACCCATCCAAAAGAACCGGGGGGGGGTATGGTTTTGGGAGAAAAAAACCGCCCCGCCGGCCAAACCGTCAAAAAAAGGAAGAGAAAGCGGGGGGGGGGGGGGGGGGAAGGATTTTTGTTTTTATAAGTTTTTTTATGGATCTCATTGCCGNCATCCGCAGCGGCCCGACACGCGTGCTCTTCTGGGGCGGAATGGTTGTGAAGGAAAGAAAAAAAAAAAAAGACAGCAAGGGGGAGCCGCGGGGGGAAAATAGGAGATAGAGTAGAAGGAGAAGAGAAAGAGGAGAGGTGGGGGCGGNNNAGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGGATGGCACAGAAAAAC