ORFeome > gng5 ORF3 – XORFeome v1.0

gng5 ORF3 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gng5
Gene ID: 963565
Gene Page ID: 963559
ORF Xenbase ID: 17277519

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC122514
Original XGC clone length: 207

Human orthology & disease relationships

NCBI Entrez ID: 2787
Ensembl gene IDs: ENSG00000174021
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 102200,103580,166350,174800

Library Location

Plate ID: GDExl11089
Well Location: C02

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGGGGCCCCTAGTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAATTTGGCACCATGCCGCCCCCACCAATGGCCCCCCCTATAAAAAAATGGTTTCACCATTTCCGCTGGAAACCCATCCCCATCCCCTTAAAGGTTCCCCAGGCTCCACCGAATTTAAGCAATTTCTCCTAACAAAAGGCCCACATTAACCCCTTCCAAATTGAATCCCCTCCAATAACAATCCCTTTCCAACCCCAAAAATCCGCCCCTTCCTTGTTCCCACTTTTCTTGAACAAATTTGCATTAATAAAAAACCTTTCTTAACCATTTTTTTCCACCAAAAAGTTCCTATTCATTCAAATTAAATCCTTAATTTCCCACCCACCTAAAACCCCCAATATTAATCCTAATAACTTGTCCTAACCGTTTTCCGGCCACCCTTGCCCCGGTCCAAAAAAAAAAAAAAAAAAAATATATTTTAATTACGCAACAAACAGGGAAAAAAAAAAGGAAAAGTCCAAACCTACCCGGGACCAATGGGGGTTCACTTTCTTTTTTGGAAAAAGGGGCCCAGCAAACCCACAACGCCAAAAACGGTTGTGGGGTTAAACCATTTGACCTTAGCCCGCCCCCCCCCCCTAAAAATATATAGAAAAATACCGGGTGGGGCGGGGGGAAGGGGGGTCTTTAATTTTTATTATATATTTTTTTTTGTTTTAATTCGCCAATTCCCCGCCCTACCACACCCACGGAATCAAAACTTTTTTTGTGCGGTGTATTTTTTATTACCAAGACCCCCCCAAACCCAAAACACGCCCCCCTTACCCACAAAGAGGTGATAATATTTTATAGAAGAGATGGGGGGAAAGAAAAGACACATAAACATAACCCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGGCCCCAGCAAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838313
dbEST ID: 79656015
Trimmed Sequence: CAAGAATGAGCAGACTTTTTGGGGTCGGAATGGATTTGTACTTGACGAGACTCCAGTTAGAAGTGGATCATGCTGAGCATTCTGTAAGCAGAACTGCTTTAAATCCGCTGCAGCCTGAGAAACCTTAACGCGATTGTGACTGGCTTCCAGCCGCAACTGGTGAACCACTTTCTTCATAGCGGAGACATTTGCTGGGGCCGACATGGTGCCAACTTTTTGGACCAAGTTTGGCTTTATAAAAATCCTTTGCTCTCCATTTGGTGCCACCAACCAGTTCCTAATCATCCAAATAAAATCCTTAATTTGGGGCCCGACCTAAAAACGGCCCTCAAAGTAAAACCGAGGAGAAGTGACTNCTGCAAAAAACACCCCCTAGGGGAGCGATAAGCGGAAGGCTCCGGAACCCCCCGGGGAACAAAATGACCCAAACGTGCTAACTGGGAAAGGGTGGCCGGGTACAGATCAACCGGGGGGTCGCGGTGAAGAGCGTTAGCAAAGAGGGAAACACCCTGCCCGGGTGCCAAATTTAATGGCGAAGAAAACCAATGGCCGGGGCGGGTGGGGTTTAAAAGGTTTTACNAAATCTTTTTGGTGGTATACTCTCTATCCCCGGGCTACCAAGGGACACGCATACACCGCTTGTTGGGGGTGTAGATGTAGTGCCTGGGGCGAGTAACAACAGCGAGCACGNGNCCTNACCAGGGGGGACAAATATAAAATGAGGTGGAGAGAGAAGAAAAAAGAAATATTACAACATAGAGGGGGGGGGGGGTGCTCCCGGN
Full Trace Sequence: GGGAAACTGCTAGTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAAAAAGTTGGCAACAAGAATGAGCAGACTTTTTGGGGTCGGAATGGATTTGTACTTGACGAGACTCCAGTTAGAAGTGGATCATGCTGAGCATTCTGTAAGCAGAACTGCTTTAAATCCGCTGCAGCCTGAGAAACCTTAACGCGATTGTGACTGGCTTCCAGCCGCAACTGGTGAACCACTTTCTTCATAGCGGAGACATTTGCTGGGGCCGACATGGTGCCAACTTTTTGGACCAAGTTTGGCTTTATAAAAATCCTTTGCTCTCCATTTGGTGCCACCAACCAGTTCCTAATCATCCAAATAAAATCCTTAATTTGGGGCCCGACCTAAAAACGGCCCTCAAAGTAAAACCGAGGAGAAGTGACTNCTGCAAAAAACACCCCCTAGGGGAGCGATAAGCGGAAGGCTCCGGAACCCCCCGGGGAACAAAATGACCCAAACGTGCTAACTGGGAAAGGGTGGCCGGGTACAGATCAACCGGGGGGTCGCGGTGAAGAGCGTTAGCAAAGAGGGAAACACCCTGCCCGGGTGCCAAATTTAATGGCGAAGAAAACCAATGGCCGGGGCGGGTGGGGTTTAAAAGGTTTTACNAAATCTTTTTGGTGGTATACTCTCTATCCCCGGGCTACCAAGGGACACGCATACACCGCTTGTTGGGGGTGTAGATGTAGTGCCTGGGGCGAGTAACAACAGCGAGCACGNGNCCTNACCAGGGGGGACAAATATAAAATGAGGTGGAGAGAGAAGAAAAAAGAAATATTACAACATAGAGGGGGGGGGGGGTGCTCCCGGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAAGAATGAGCAGACTTTTTGG