ORFeome > gng7 ORF1 – XORFeome v1.0

gng7 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gng7
Gene ID: 969606
Gene Page ID: 969600
ORF Xenbase ID: 17277525

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC047249
Original XGC clone length: 207

Human orthology & disease relationships

NCBI Entrez ID: 2788
Ensembl gene IDs: ENSG00000176533
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 102200,103580,166350,174800

Library Location

Plate ID: GDExl11016
Well Location: A08

Sequences - 5ʹ (forward) EST

Accession: JZ824298
dbEST ID: 79642000
Trimmed Sequence: ATGTCAACCTCTAATAACATAGCACAGGCTCGGAAGCTGGTGGAGCAGCTGAGACTTGAGGGCTGGAATAGAGAGAGTTAAGGTCTCCAAAGCTGCCGCAGACCTTATGAACTACTGTGAGCAACATGCCAAAAATGACCCTCTGCTGGTTGGAATGCCAACTTCAGAGAATCCATTTAAAGATAAAAAGCCATGTTCCATTTTATT
Full Trace Sequence: GCACAATTGGATTTATTTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCAACCTCTAATAACATAGCACAGGCTCGGAAGCTGGTGGAGCAGCTGAGACTTGAGGGCTGGAATAGAGAGAGTTAAGGTCTCCAAAGCTGCCGCAGACCTTATGAACTACTGTGAGCAACATGCCAAAAATGACCCTCTGCTGGTTGGAATGCCAACTTCAGAGAATCCATTTAAAGATAAAAAGCCATGTTCCATTTTATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCGTCCGGGTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCAAAAAGTTACATTTTCACTTGGGNGTCTTTCGGCTTCAACTGGATTTGCCGCCTCTATACTTACTAGTTGTGCTTCAGTTTCTGTAAGTTCTAGGGTATCGACCTGCACACTGGCTGTGTATAATGGAGCCTGACAATTATATTCCCCAGAACATCAGGTTAATGGTGTGTTGTGATGTCGTTTTCGAGGTGGCTGAGATCAGCCACATCTGACACGAATAAGGACACCGGGACAATGCTCATATCGGGGGGACTTATGGGCCCGGTTTCTTCCCGAAAATCAACCACGTGGAAGGTTACTGGCGAGAAATTATTTGAACTCAAAAATTGCGCTGGGCTCAGAGGGAACTTATACCCGCCGGCCGGGGCGGGGCCAAAAAATATCCCCCTGATAAAATCCACTAAAACGGGAAAAATAACGGGGTCTCTCCTCTTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAACCTCTAATAACATAGCA

Sequences - 3ʹ (reverse) EST

Accession: JZ829641
dbEST ID: 79647343
Trimmed Sequence: TAAAATGGAACATGGCTTTTTATCTTTAAATGGATTCTCTGAAGTTGGCATTCCAACCAGCAGAGGGTCATTTTTGGCATGTTGCTCACAGTAGTTCATAAGGTCTGCGGCAGCTTTGGAGACCTTAACTCTCTCTATTCCAGCCTCAAGTCTCAGCTGCTCCACCAGCTTCCGAGCCTGTGCTATGTTATTAGAGGTTGACATGG
Full Trace Sequence: CTGCACGGGAACAGCTATGAACATGTAATACGACTCACTATAGGGGAAATCAGCTTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAAAAAATTTGGCAATAAAATGGAACATGGCTTTTTATCTTTAAATGGATTCTCTGAAGTTGGCATTCCAACCAGCAGAGGGTCATTTTTGGCATGTTGCTCACAGTAGTTCATAAGGTCTGCGGCAGCTTTGGAGACCTTAACTCTCTCTATTCCAGCCTCAAGTCTCAGCTGCTCCACCAGCTTCCGAGCCTGTGCTATGTTATTAGAGGTTGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAAGACTGAACAAAAAATTACAACTCATGAACTGAGATGTTCCGGACAAACTGACGGAAGAATGTAGAAAACACTGACTGCACATACCACCGTTGATATATCCTAATCGCATAGCTGAGAAGATCCTCAGGCATTTCTCTCACTTGTTCAATGTACTAAATAAACATGCGGCTCAGTTGGACATTATGGACTTTGTATCGAGCCTACCGATTACTAGCCCCTAGATTTTATCAGGCCATGAGTCACATACTTAACTCGCCTGATTAAAGCTATTTGGGCATTCCAAATCGTCAGTGAGAAATTTCGAGCGGGGCTATATGGAAGACGGAATACCTTGTTGTTAGCTCAGATTCTCCAGAGATACAACTAGAACGCTTTTGCCCTCCGTTCTGTGGAGTCAAAATACCAGGGGAACAATTTTGCCAGCCGGGGTTTCCTACCGGGGTAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAAAATGGAACATGGCTTTTTAT