ORFeome > gnl3 ORF1 – XORFeome v1.0

gnl3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gnl3
Gene ID: 6253784
Gene Page ID: 6456132
ORF Xenbase ID: 17277549

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045248
Original XGC clone length: 1629

Human orthology & disease relationships

NCBI Entrez ID: 26354
Ensembl gene IDs: ENSG00000163938
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 103050,180105,268000,608688,610015

Library Location

Plate ID: GDExl11013
Well Location: C09

Sequences - 5ʹ (forward) EST

Accession: JZ824103
dbEST ID: 79641805
Trimmed Sequence: ATGAAACGTCCGAAGCTAAGGAAATCCAGCAAACGCCTGAGCTGCCACAAACGCTACAAAATCCAGAAAAAGGTCCGGGAGCACAAGCGCAAGGTGAAGAAGGAGGCCAAGAAGAGCGGCCCCAGGAAACACAAGAAAGACATCACTGTCCCTAACGCTGCCCCATTCAAAGCTCAGATCCTGCAGGAGGCGCAACTCCGACGCCAGCAGCAAGAGGAATTGAAGCAAAAGCAGAAATTAGATCGACAGAAGGAAGTGGCAAAGAAACGAAAGTTGGAGGAGAAGAAAAATAACAATTCTGAAAAGAAAGAAAAAAGGGATAAAAAGAGAAAAGAAACTAAAACTCCTGACGATCCGGACGTGGTTTTGTGTCGGCAGGTGAACAAGGTGCTGGAGCAGAGCGATGTTATTGTGGAGGTTCTGGATGCCAGGGACCCATTGGGCAGTCGATGTTCTCAGGCGGAGGAAGTCGTCCTTAAATCCCCCAATAAGAGACTTCTGCTCCTTCTCAATAAATCAGATCTTGTGCCCAGGGAGATGGTAGAGAAGTGGCTGCAGGTTCTGAGCGCTGAGCTTCCCACCGTGCCGTTCAGATGTGTTGCACAAATACAGGACAAGAGTGAGAAGAAGAAGAAGAAGAAGGTTCCCGTCAGCGCTGATCTGGTCACAGACTCAAATGTCCCGGGGGGGCAGTCTTACTGAAGAATCTTCACAAGCTGTGCCCCTCCCCCATGAGGCAATAAAAGTGGGGGTGGTTGGAATTTTCCAACTGGGGGAAAAAAAAGTGGTCCCCACAACCCTGAAAAAACTTTCCCTCGTTGGGTTAAAGCTCCGCCCT
Full Trace Sequence: AATGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAACGTCCGAAGCTAAGGAAATCCAGCAAACGCCTGAGCTGCCACAAACGCTACAAAATCCAGAAAAAGGTCCGGGAGCACAAGCGCAAGGTGAAGAAGGAGGCCAAGAAGAGCGGCCCCAGGAAACACAAGAAAGACATCACTGTCCCTAACGCTGCCCCATTCAAAGCTCAGATCCTGCAGGAGGCGCAACTCCGACGCCAGCAGCAAGAGGAATTGAAGCAAAAGCAGAAATTAGATCGACAGAAGGAAGTGGCAAAGAAACGAAAGTTGGAGGAGAAGAAAAATAACAATTCTGAAAAGAAAGAAAAAAGGGATAAAAAGAGAAAAGAAACTAAAACTCCTGACGATCCGGACGTGGTTTTGTGTCGGCAGGTGAACAAGGTGCTGGAGCAGAGCGATGTTATTGTGGAGGTTCTGGATGCCAGGGACCCATTGGGCAGTCGATGTTCTCAGGCGGAGGAAGTCGTCCTTAAATCCCCCAATAAGAGACTTCTGCTCCTTCTCAATAAATCAGATCTTGTGCCCAGGGAGATGGTAGAGAAGTGGCTGCAGGTTCTGAGCGCTGAGCTTCCCACCGTGCCGTTCAGATGTGTTGCACAAATACAGGACAAGAGTGAGAAGAAGAAGAAGAAGAAGGTTCCCGTCAGCGCTGATCTGGTCACAGACTCAAATGTCCCGGGGGGGCAGTCTTACTGAAGAATCTTCACAAGCTGTGCCCCTCCCCCATGAGGCAATAAAAGTGGGGGTGGTTGGAATTTTCCAACTGGGGGAAAAAAAAGTGGTCCCCACAACCCTGAAAAAACTTTCCCTCGTTGGGTTAAAGCTCCGCCCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAACGTCCGAAGCTAAGGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829411
dbEST ID: 79647113
Trimmed Sequence: TACAAAGTCGGTGTTGAAATCGTAAGTGTCATCATCTGCAGCCTGATCAAAGCTCACGGCCGGACCGGCTGATTTTGAATCCTTTTCTTTTGCAGATGTCACTTCCTGTGTCAGACTCTTGGCTTCCAGGTCCTCTTCCTCCTCACTGCCTTCATCATCATCTTCTTCCTCCTCCATATCCTCCTCCTCCTCTCCATCATTTTCTTCTAACTCTTCTTCAATCAGCTCTGGTTCTGGATCCACCAATTGGGTCTCATCCATGATGGCGCTGGTAGGTCCAACGGAGGCAAAGACCACTATGTTGGCAGAGTTGGGGCATTTTAGGGCTTTCAGGGTAGAAGCGTTGTCCATGGCCAGCTCCTCGCTACAGATGCCGCTGCTCATCGCTGCCACAACCTCTCTGCTGATGTGGGGCTGACAGACAGGAGAGTCGGGGGGCCGGCAGTAATATTTCATTCTTGCTCCCATCCAATCATTAAACAGCAGTCGTCCGGCCCCCTCTGTGTCAGGCACGCCCCCTTTCTTCAGCATCCCCCGTCTGTGCGCGAGTAACGTGAGACATTCCAGGCTGTTCCTATAGTCAGCAATGGTGTAATGCAACATCAGCTCCTGGTTGGAGCAGTGGTTCAAGATGGCTTCCCACCGCAGCCCAAACGTTCCACTTTATTCTCAAAAGCAATTTTTTAACATTAAAGGCAAATGGGGGGGAATTGGGGGGGGGGAAACCCCAAAAAGGGGGCAGGGGGCCTGTTCTTAAAACAATTCTT
Full Trace Sequence: GTGCCAGGTAGCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATACAAAGTCGGTGTTGAAATCGTAAGTGTCATCATCTGCAGCCTGATCAAAGCTCACGGCCGGACCGGCTGATTTTGAATCCTTTTCTTTTGCAGATGTCACTTCCTGTGTCAGACTCTTGGCTTCCAGGTCCTCTTCCTCCTCACTGCCTTCATCATCATCTTCTTCCTCCTCCATATCCTCCTCCTCCTCTCCATCATTTTCTTCTAACTCTTCTTCAATCAGCTCTGGTTCTGGATCCACCAATTGGGTCTCATCCATGATGGCGCTGGTAGGTCCAACGGAGGCAAAGACCACTATGTTGGCAGAGTTGGGGCATTTTAGGGCTTTCAGGGTAGAAGCGTTGTCCATGGCCAGCTCCTCGCTACAGATGCCGCTGCTCATCGCTGCCACAACCTCTCTGCTGATGTGGGGCTGACAGACAGGAGAGTCGGGGGGCCGGCAGTAATATTTCATTCTTGCTCCCATCCAATCATTAAACAGCAGTCGTCCGGCCCCCTCTGTGTCAGGCACGCCCCCTTTCTTCAGCATCCCCCGTCTGTGCGCGAGTAACGTGAGACATTCCAGGCTGTTCCTATAGTCAGCAATGGTGTAATGCAACATCAGCTCCTGGTTGGAGCAGTGGTTCAAGATGGCTTCCCACCGCAGCCCAAACGTTCCACTTTATTCTCAAAAGCAATTTTTTAACATTAAAGGCAAATGGGGGGGAATTGGGGGGGGGGAAACCCCAAAAAGGGGGCAGGGGGCCTGTTCTTAAAACAATTCTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATACAAAGTCGGTGTTGAAATCGT