ORFeome > gnl3l ORF1 – XORFeome v1.0

gnl3l ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gnl3l
Gene ID: 5765778
Gene Page ID: 5765746
ORF Xenbase ID: 17277555

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC125997
Original XGC clone length: 1686

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: A02

Sequences - 5ʹ (forward) EST

Accession: JZ837376
dbEST ID: 79655078
Trimmed Sequence: ATGTCCAGGAACAAGCACAAACGGCCGGGAAAAGGAACTCACAGGGGCAAGGGTAGGGGATCAGCGCAGCATGGCAAGAATATCAAGAAAGACCCTGGAGTGCCCAACCTGTCCCATTTCAAAGAGCAAGCGAAGAGAGAGGCCGAGCAGAAGAAGAAAAGGGTGGAAGAGATGAGAGAGAAGCAGAAAGCGGCCAGACAGAAGGAAATGGCAAAGAGGAGGAGCCTGGACACTTTTCAAAAAGATGTTATGAAGCGCCAAAGAGAGTTTGAACAAAAGGAGGCCGATCTGCGGAGTCTGGAGAAGCACGAGCAGCTGGAGAATGAAAATTCCAGGAAGGCTTATTACCGGGAGTTCAAAAAGGTGGTAGAGGCGGCAGATGTCATATTAGAAGTGCTGGATGCCAGGGATCCTTTGGGTTGCCGTTGCCCCCAAGTGGAGCAGGCTGTAGTACAGTCTGGCACAGAGAAGAAGTTGGTGCTAGTCCTAAATAAAATAGATCTCGTCCCTAAACCTGTCGTGGAGAAGTGGTTGAAGTATCTCAGGAATGAGTTCCCTACAGTGGCCTTCAAAGCCTCCACACAACAGCAGAACAAGAATTTGCAACAAAGCAAAGTGCCAGTCAGGCAGGCATCTGAGGATCTGCTGAGCACTGGACCCTGCATTGAAGCTGATTCTCTAATGAAACTCCTGGGCCATTTACTGGCGAAAAAGGGACATCAAGACCTCTAAAAAATGTTGGAAAATTTGAAGGGGTGTCCAAATGGGGGGAAAAGAAAGCAGGTGTGGATAAAACAAGTTCTTAAAAAAAAA
Full Trace Sequence: GCGGGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCAGGAACAAGCACAAACGGCCGGGAAAAGGAACTCACAGGGGCAAGGGTAGGGGATCAGCGCAGCATGGCAAGAATATCAAGAAAGACCCTGGAGTGCCCAACCTGTCCCATTTCAAAGAGCAAGCGAAGAGAGAGGCCGAGCAGAAGAAGAAAAGGGTGGAAGAGATGAGAGAGAAGCAGAAAGCGGCCAGACAGAAGGAAATGGCAAAGAGGAGGAGCCTGGACACTTTTCAAAAAGATGTTATGAAGCGCCAAAGAGAGTTTGAACAAAAGGAGGCCGATCTGCGGAGTCTGGAGAAGCACGAGCAGCTGGAGAATGAAAATTCCAGGAAGGCTTATTACCGGGAGTTCAAAAAGGTGGTAGAGGCGGCAGATGTCATATTAGAAGTGCTGGATGCCAGGGATCCTTTGGGTTGCCGTTGCCCCCAAGTGGAGCAGGCTGTAGTACAGTCTGGCACAGAGAAGAAGTTGGTGCTAGTCCTAAATAAAATAGATCTCGTCCCTAAACCTGTCGTGGAGAAGTGGTTGAAGTATCTCAGGAATGAGTTCCCTACAGTGGCCTTCAAAGCCTCCACACAACAGCAGAACAAGAATTTGCAACAAAGCAAAGTGCCAGTCAGGCAGGCATCTGAGGATCTGCTGAGCACTGGACCCTGCATTGAAGCTGATTCTCTAATGAAACTCCTGGGCCATTTACTGGCGAAAAAGGGACATCAAGACCTCTAAAAAATGTTGGAAAATTTGAAGGGGTGTCCAAATGGGGGGAAAAGAAAGCAGGTGTGGATAAAACAAGTTCTTAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCAGGAACAAGCACAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837375
dbEST ID: 79655077
Trimmed Sequence: GTCATCGCTCAGTGAAAAATTCATTGCTAGCGTTAATGAATCTGACAGTTTTGTTGCAATTTTGTTTGCTCGCTTTTGCATCTTTTTCCTCTTCTTGCTTGCGGCGAGCAGGGCCTGTCCTTGCTGCAGAGGGTCAATAGCTTGAATCTCCTTTAGATTTGGGGCTTTGGGAACCACTTGTTCTGTTTCTGGCTGGACTTTGCTTTTTTGGGCTTTGATTTCCACAGTCATGGGACCAAACTCTGTATCAATGTCCTGTTCCATGGAATCAGTTGGTTTTTCATCCTCACCACTTGACTCATCCAGTTCAACATCCTCCACCTCTTCTTCGACACCAGCTGTGAGTCCACAGACCTCCATAACAATGCCCTGCGGGGCTGACTGAACCTTTGACAAAGACTCATGGTTGTCCATCTCCAAGGCCTCAAAATCAAATGCCTTCCCCATTTCTGTAACAATCTCCGCACTGATGTGTGTAGGCATTGTGTGGGTCTCCGGAGGATGTGTGAAGTAACTGATTTTACCACTCACCCAATCTGTAAGGACGGACTTAGCAGCCTTCTCATGATCCGGTGTGCCACCCTTTTTCAGCTTACCCTGCCGTTTAGCCCGCATGGCCAGGAACTCCAGTGTATCTCGAAAATTGGCTCACTTTTGAATGTTTAAATGATCTGGGTCCTTGTTTCACCCGTCCTCAATATGGCCTTCCACTGGGGCCCCACCGGAAACA
Full Trace Sequence: GAGACAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGNCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCATCGCTCAGTGAAAAATTCATTGCTAGCGTTAATGAATCTGACAGTTTTGTTGCAATTTTGTTTGCTCGCTTTTGCATCTTTTTCCTCTTCTTGCTTGCGGCGAGCAGGGCCTGTCCTTGCTGCAGAGGGTCAATAGCTTGAATCTCCTTTAGATTTGGGGCTTTGGGAACCACTTGTTCTGTTTCTGGCTGGACTTTGCTTTTTTGGGCTTTGATTTCCACAGTCATGGGACCAAACTCTGTATCAATGTCCTGTTCCATGGAATCAGTTGGTTTTTCATCCTCACCACTTGACTCATCCAGTTCAACATCCTCCACCTCTTCTTCGACACCAGCTGTGAGTCCACAGACCTCCATAACAATGCCCTGCGGGGCTGACTGAACCTTTGACAAAGACTCATGGTTGTCCATCTCCAAGGCCTCAAAATCAAATGCCTTCCCCATTTCTGTAACAATCTCCGCACTGATGTGTGTAGGCATTGTGTGGGTCTCCGGAGGATGTGTGAAGTAACTGATTTTACCACTCACCCAATCTGTAAGGACGGACTTAGCAGCCTTCTCATGATCCGGTGTGCCACCCTTTTTCAGCTTACCCTGCCGTTTAGCCCGCATGGCCAGGAACTCCAGTGTATCTCGAAAATTGGCTCACTTTTGAATGTTTAAATGATCTGGGTCCTTGTTTCACCCGTCCTCAATATGGCCTTCCACTGGGGCCCCACCGGAAACA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCATCGCTCAGTGAAAAATTCAT