ORFeome > gns ORF1 – XORFeome v1.0

gns ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gns
Gene ID: 978433
Gene Page ID: 978428
ORF Xenbase ID: 17277585

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC042274
Original XGC clone length: 1644

Human orthology & disease relationships

NCBI Entrez ID: 2799
Ensembl gene IDs: ENSG00000135677
Directly associated (OMIM) disease MIM numbers: 252940
Indirectly associated (Lage, et al.) disease MIM numbers: 143500,218800,237900,252940,606785

Library Location

Plate ID: GDExl11016
Well Location: C12

Sequences - 5ʹ (forward) EST

Accession: JZ824394
dbEST ID: 79642096
Trimmed Sequence: ATGGCTCGGTGTTTACTGCGCACTATGCTTCGACCTGGCACCGAGGCGCCGCGGATCTACCTGCTCCTCCTCCTCCTGGGGCTCCTGGGGCCGTCACTTCTCTATGTGGCGGGGAGGTCTCGAAAGGCAAATGTTGTGCTCATTCTGACAGATGATCAGGACGTGTCTCTGGGCGGCATGACCCCGCTGACGAAGACCAAGGAGTTAATTGCAGATCATGGAATGACCTTTTCAAATGCTTATGTAGCCAGTGCCTTGTGCTGCCCAAGCAGATCCAGCATCCTGACTGGGCGATATCCACATAATCACCATGTCCTCAACAACACTATATCAGGAAACTGCAGCAGCAAAGCTTGGCAGAAGACTCAGGAGCCGTACACTTTCCCTGCCCTCCTTTACTCCATCGGCTACCAGACTTTCTTTGCTGGGAAGTATTTAAATCAGTATGGCTCAGAGGAAGCTGGAGGGATAAATCACGTGCCCCCTGGCTGGAGTTACTGGTTTGCGCTGGAGAAAAATTCAAAGTATTATAACTACACTCTGTCAGAAAATGGCCGACCAAAAACCCATGGGGAAAACTACAGTCAGGATTATCTGACCGATGTCTTGTCCAATGTCTCGTTGGATTTCTTGAACTACAAATCTAACCATGAGCCATTCTTCATGATGATCGCAACACCAGCCCCACACTCTACATGGACTGCCGCCCCTCAATACGAGGATGCCCTTCCTGAATGTCAATGCTTCCAGGGGGAGGCAATTTTAAT
Full Trace Sequence: AGTCGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTCGGTGTTTACTGCGCACTATGCTTCGACCTGGCACCGAGGCGCCGCGGATCTACCTGCTCCTCCTCCTCCTGGGGCTCCTGGGGCCGTCACTTCTCTATGTGGCGGGGAGGTCTCGAAAGGCAAATGTTGTGCTCATTCTGACAGATGATCAGGACGTGTCTCTGGGCGGCATGACCCCGCTGACGAAGACCAAGGAGTTAATTGCAGATCATGGAATGACCTTTTCAAATGCTTATGTAGCCAGTGCCTTGTGCTGCCCAAGCAGATCCAGCATCCTGACTGGGCGATATCCACATAATCACCATGTCCTCAACAACACTATATCAGGAAACTGCAGCAGCAAAGCTTGGCAGAAGACTCAGGAGCCGTACACTTTCCCTGCCCTCCTTTACTCCATCGGCTACCAGACTTTCTTTGCTGGGAAGTATTTAAATCAGTATGGCTCAGAGGAAGCTGGAGGGATAAATCACGTGCCCCCTGGCTGGAGTTACTGGTTTGCGCTGGAGAAAAATTCAAAGTATTATAACTACACTCTGTCAGAAAATGGCCGACCAAAAACCCATGGGGAAAACTACAGTCAGGATTATCTGACCGATGTCTTGTCCAATGTCTCGTTGGATTTCTTGAACTACAAATCTAACCATGAGCCATTCTTCATGATGATCGCAACACCAGCCCCACACTCTACATGGACTGCCGCCCCTCAATACGAGGATGCCCTTCCTGAATGTCAATGCTTCCAGGGGGAGGCAATTTTAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCGGTGTTTACTG

Sequences - 3ʹ (reverse) EST

Accession: JZ829751
dbEST ID: 79647453
Trimmed Sequence: CCGCAAAGTCTTTCTGCTTAAGGTGTGTCCTTGTTCCACTTGGTCCTTAAACATCAACCGAGGCTCAAACCTGTACCTTGGATCAAACACTCCTGGGGTGTGACATGATGGCCCAGAACAAGACTGTAACATCATAAGGCGATGGTTCATCTTCTCCAGGATCTCCTGGTCAATGGTTTTTGCTATGTTTGTTAGTTGGTTTGGATCTGCGGTTATATTATACACTTCCACAAAGACCTCCGCATCATCAAACTCACAGTACTGCAAGTCGTAGGCAGCTGCAATGGTTCTCACACAGGCATATGTGTTGTTGTACGAGTCTTCACATACACAGTCAGGAAAACATTGAGAAACTCCAGGGCGCAGTGTTGGGCAGTTTGGGTCTGATGTATTGCTTCCTTCCCCTTGGTATTCAACCAAAATATCTGTTCGCCAATTTACATTAGTGTTATTTATCATAAGTGGAAGGAATGACATCCCATCCATCTGAGTCTTGTTCAAGTCATAGCCAGCAATGTCCAGAATGGTTGGGCCTAGATCAATATTTGCAACCAGTGATTTAGTTATTTTGGTTAGGTTTGATCCCANGCCCTCGAACAAGCAGTGGAACTTTGATGTCGAATTCATAAGAGCTGCCGTTTGTCTATCGGCAGTGAAAACCTGGCCTGGGTGGAATCCCTTTGTTCTGATGTAAAAAAAGAAAAAAAGGGGTTTTCCCCCCTTCACCGGCCGGACTTTCTAGTCTCGCCTTTTCAAAAGGTTTCCCTTACCCCAAATCAT
Full Trace Sequence: TGCCGGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCGCAAAGTCTTTCTGCTTAAGGTGTGTCCTTGTTCCACTTGGTCCTTAAACATCAACCGAGGCTCAAACCTGTACCTTGGATCAAACACTCCTGGGGTGTGACATGATGGCCCAGAACAAGACTGTAACATCATAAGGCGATGGTTCATCTTCTCCAGGATCTCCTGGTCAATGGTTTTTGCTATGTTTGTTAGTTGGTTTGGATCTGCGGTTATATTATACACTTCCACAAAGACCTCCGCATCATCAAACTCACAGTACTGCAAGTCGTAGGCAGCTGCAATGGTTCTCACACAGGCATATGTGTTGTTGTACGAGTCTTCACATACACAGTCAGGAAAACATTGAGAAACTCCAGGGCGCAGTGTTGGGCAGTTTGGGTCTGATGTATTGCTTCCTTCCCCTTGGTATTCAACCAAAATATCTGTTCGCCAATTTACATTAGTGTTATTTATCATAAGTGGAAGGAATGACATCCCATCCATCTGAGTCTTGTTCAAGTCATAGCCAGCAATGTCCAGAATGGTTGGGCCTAGATCAATATTTGCAACCAGTGATTTAGTTATTTTGGTTAGGTTTGATCCCANGCCCTCGAACAAGCAGTGGAACTTTGATGTCGAATTCATAAGAGCTGCCGTTTGTCTATCGGCAGTGAAAACCTGGCCTGGGTGGAATCCCTTTGTTCTGATGTAAAAAAAGAAAAAAAGGGGTTTTCCCCCCTTCACCGGCCGGACTTTCTAGTCTCGCCTTTTCAAAAGGTTTCCCTTACCCCAAATCAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCGCAAAGTCTTTCTGCTTA