ORFeome > golph3l ORF2 – XORFeome v1.0

golph3l ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: golph3l
Gene ID: 1003095
Gene Page ID: 1003087
ORF Xenbase ID: 17277609

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC127437
Original XGC clone length: 843

Human orthology & disease relationships

NCBI Entrez ID: 55204
Ensembl gene IDs: ENSG00000143457
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 188550,231550

Library Location

Plate ID: GDExl11085
Well Location: H04

Sequences - 5ʹ (forward) EST

Accession: JZ837756
dbEST ID: 79655458
Trimmed Sequence: ATGACCACTTTAATTCGACGTGGTCGACGCGCAGAAGAGGGTCAGGAACGCAGGGCGGATTCAGAAGATTCCATCAAAGACAAAGATGAGGAAGACTCGGCCGATTCTAAGGAAATTCGCCTGACGCTTATGGAGGAAGTGTTGCTTCTAGGACTCAAAGATAAGGAGGGTTACACATCCTTCTGGAACGATTGCATCTCGTCGGGCCTACGTGGAGGAATCCTGATCGAGCTTTTCCTGAGGGGCCGGGTGGTCTTAGAGCCAGCGACCATACGGAAGAAACGGCTGACTGACAAGAAGGTGCTGCTGAAGTCCGATAAACTCACAGGAGATGTTCTGTTGGATGAGACCATAAAGCATATGAAGGCAACGGAACCCGCAGAAACCGTGCACAGCTGGATAGAGTTACTCACAGGTGAAACATGGAACCCCTTTAAGCTGCAGTACCAGCTGCGTAATGTCCGGGAACGCATAGCCAAGAACCTTGTGGAGAAGGGGATCCTCACCACAAAGAAGCAGAACTTCCTTCTGTTTGACATGACCACCCACCCTGTCCCCCACCCCACAGAGAAGCAACGGTTGGGTGAAGAACCTGCAGAAAGCCCGCTGGAAGAATTGGGTCAGGGACCCCGACCGAAGGGACAAAGGGACCCTGGCGCCGGCGGGGGCCGGGTGACTCCTCTGATGTTTCGGGAGGATGGCGTACTCTGCTTCCCCCGATAAGAAAGTATAAGGTGGGCCG
Full Trace Sequence: CGGGGGCCAAATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACCACTTTAATTCGACGTGGTCGACGCGCAGAAGAGGGTCAGGAACGCAGGGCGGATTCAGAAGATTCCATCAAAGACAAAGATGAGGAAGACTCGGCCGATTCTAAGGAAATTCGCCTGACGCTTATGGAGGAAGTGTTGCTTCTAGGACTCAAAGATAAGGAGGGTTACACATCCTTCTGGAACGATTGCATCTCGTCGGGCCTACGTGGAGGAATCCTGATCGAGCTTTTCCTGAGGGGCCGGGTGGTCTTAGAGCCAGCGACCATACGGAAGAAACGGCTGACTGACAAGAAGGTGCTGCTGAAGTCCGATAAACTCACAGGAGATGTTCTGTTGGATGAGACCATAAAGCATATGAAGGCAACGGAACCCGCAGAAACCGTGCACAGCTGGATAGAGTTACTCACAGGTGAAACATGGAACCCCTTTAAGCTGCAGTACCAGCTGCGTAATGTCCGGGAACGCATAGCCAAGAACCTTGTGGAGAAGGGGATCCTCACCACAAAGAAGCAGAACTTCCTTCTGTTTGACATGACCACCCACCCTGTCCCCCACCCCACAGAGAAGCAACGGTTGGGTGAAGAACCTGCAGAAAGCCCGCTGGAAGAATTGGGTCAGGGACCCCGACCGAAGGGACAAAGGGACCCTGGCGCCGGCGGGGGCCGGGTGACTCCTCTGATGTTTCGGGAGGATGGCGTACTCTGCTTCCCCCGATAAGAAAGTATAAGGTGGGCCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACCACTTTAATTCGACGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ837755
dbEST ID: 79655457
Trimmed Sequence: GGATTTGTTAAATGCAGAGAGCACAGCCCAGATCATCTCGCAGGCGTTGGGTTTCGTTCCTTCTGTATCTGGTTCCAGGTCCAAAAGTTCTTTGGACCGGATCATGGCCATGTCATATTTCTCATCGGAGAGGGAAGAGAAGGCATTCTCCAGAACATCAGATGAGTGAGCTAGCACCAGTAGGGCCAGGGTCCGTTTGTCCATTCGGTGGGGGTCGTTGACCCATTTCTCTAGCAGGCTTTCTTGCAGCTTTTTTACCAACCGTTGCTTCTCTGTGGTGTTGGTGACGCGGTGGGGGGGGATGTCGAAAACAAAGAAGTTGTGCTGTTCTGTGGGGAGGAGCGCCTTCTCCACAAGGTTGGTGGGGGGGGGTTGGCGGGGGGTACACAACTGGGGGTGCAGCTGGGAGAGGGGGGGGGGTTCGCCGCGGGGGAAGTCGGTGGGGAGGGGGGGCGCGTGTCCGGGGGGGCGTAGGTTGCCATAGTGTGTGGGGGGGCCGGGCAGAAGGTATCCACCGGGGGGGGGAGAGGGGGGGGGGGAAGGCTTGTGGAGGGGGGGGGTGGGGGATAGGGGGGGGGGCGGGGGGGACGGGAGGGCGGGGCGCCAGGAGGGGGGGGGGGGGGGGGTCCCCCGGGGGGGGGGGGAAGGAGGGCCGTGCGGCGGGAGGGGGGGGGGAGCATTGGGGGGGTGGGGGGGGGGAAGAGAATTCGCGGCGGGGAAGGAGGAGGGGAGTGGGGGGACCGGGGGGGGGGGGGGGGGGCGGGGTGGGGGGGGGGGGGGGGGCCAAGACGGACCCGGGGGTGGGGGGGGAGGGGGGGGGGGGGGAGGAAGGAAAAGGAAAGAGGGGGGGGGGGGGGGGATCCTGAGGGGGGGGGGGAAGAGGGGAGAAGAATACGGGGGGGGGGGGGGTGGGGNNTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGTTGTTTCCTGAACGGAGAGGGGAGAAAGACGCCCTAATTCGAAGGCCCCCGTGGGGGGGGGGGGGGCTCCGGGTGATAAGGGGGTGTTGTGGGACCCCCCGGCGACGAGAACAGGGGCGGGGGGCGCGGACAGAGGGAGAAGATAAAACGAGGGGGGCCCCCCGGCCCCCCGGCGCCGGAACCCATTACCAGGCCAAGCCACGGGGGGG
Full Trace Sequence: GGGCAGGGGATCAGCTTATGACCATGGTAAACGACTCACTACTAGGGGATATCAGCTTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGATTTGTTAAATGCAGAGAGCACAGCCCAGATCATCTCGCAGGCGTTGGGTTTCGTTCCTTCTGTATCTGGTTCCAGGTCCAAAAGTTCTTTGGACCGGATCATGGCCATGTCATATTTCTCATCGGAGAGGGAAGAGAAGGCATTCTCCAGAACATCAGATGAGTGAGCTAGCACCAGTAGGGCCAGGGTCCGTTTGTCCATTCGGTGGGGGTCGTTGACCCATTTCTCTAGCAGGCTTTCTTGCAGCTTTTTTACCAACCGTTGCTTCTCTGTGGTGTTGGTGACGCGGTGGGGGGGGATGTCGAAAACAAAGAAGTTGTGCTGTTCTGTGGGGAGGAGCGCCTTCTCCACAAGGTTGGTGGGGGGGGGTTGGCGGGGGGTACACAACTGGGGGTGCAGCTGGGAGAGGGGGGGGGGTTCGCCGCGGGGGAAGTCGGTGGGGAGGGGGGGCGCGTGTCCGGGGGGGCGTAGGTTGCCATAGTGTGTGGGGGGGCCGGGCAGAAGGTATCCACCGGGGGGGGGAGAGGGGGGGGGGGAAGGCTTGTGGAGGGGGGGGGTGGGGGATAGGGGGGGGGGCGGGGGGGACGGGAGGGCGGGGCGCCAGGAGGGGGGGGGGGGGGGGGTCCCCCGGGGGGGGGGGGAAGGAGGGCCGTGCGGCGGGAGGGGGGGGGGAGCATTGGGGGGGTGGGGGGGGGGAAGAGAATTCGCGGCGGGGAAGGAGGAGGGGAGTGGGGGGACCGGGGGGGGGGGGGGGGGGCGGGGTGGGGGGGGGGGGGGGGGCCAAGACGGACCCGGGGGTGGGGGGGGAGGGGGGGGGGGGGGAGGAAGGAAAAGGAAAGAGGGGGGGGGGGGGGGGATCCTGAGGGGGGGGGGGAAGAGGGGAGAAGAATACGGGGGGGGGGGGGGTGGGGNNTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGTTGTTTCCTGAACGGAGAGGGGAGAAAGACGCCCTAATTCGAAGGCCCCCGTGGGGGGGGGGGGGGCTCCGGGTGATAAGGGGGTGTTGTGGGACCCCCCGGCGACGAGAACAGGGGCGGGGGGCGCGGACAGAGGGAGAAGATAAAACGAGGGGGGCCCCCCGGCCCCCCGGCGCCGGAACCCATTACCAGGCCAAGCCACGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGATTTGTTAAATGCAGAGAGCAC