ORFeome > gorasp2 ORF1 – XORFeome v1.0

gorasp2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gorasp2
Gene ID: 943273
Gene Page ID: 943265
ORF Xenbase ID: 17277621

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043840
Original XGC clone length: 1278

Human orthology & disease relationships

NCBI Entrez ID: 26003
Ensembl gene IDs: ENSG00000115806
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 140350,241500,241510,248900,276710,601675,606952,608611

Library Location

Plate ID: GDExl11015
Well Location: C08

Sequences - 5ʹ (forward) EST

Accession: JZ824218
dbEST ID: 79641920
Trimmed Sequence: ATGGGGGGCTCGAACAGCGTGGAGATCCCTGGAGGAGGAACTGAAGGCTATCATGTCTTGCGGGTTCAAGAGAATTCCCCGGGACACAGAGCTGGCCTGGAGCCGTTCTTTGATTTTATTGTTTCTATCAATGGAATAAGGCTTAATAAAGATAATGACACACTTAAAGATCTGCTAAAAGCCAATGTGGAGAAGCCCGTAAAGATGGTGGTGTACAGCAGCAAGACACTGGAACTGAGGGAAACGACAGTGACGCCGAGTAATATGTGGGGTGGGCAAGGTTTACTGGGAGTCAGTATACGCTTCTGCAGCTTCGAAGGAGCAAATGAGAACGTATGGCATGTATTGGAGGTGGAACCAAACTCTCCTGCGGTACTGGCTGGGCTCAGACCCCACAGTGATTATATAATTGGAGCGGACACTGTAATGAATGAGTCTGAGGATCTATTCTCCCTCATTGAGACACATGAAGGAAAGCCTTTAAAACTTTATGTGTACAACACAGACACGGACAACTGTAGAGAGGTTGTCATCACGCCAAACACTGCATGGGGCTGGTGAGGGCAGTCTAGGGTGCGGAATCGGCTACGGTTACCTCCATCGGATACCAACAAGACCCTTTGAAGAGGGAAAGAATATCTCTTTGCCTGGACAAGTTCCAGGAGCCCCAGTGAGTCCTCTAAAAGATGGCTTTACAGAGGTACAGCTGTCGTCTGTAAATTTCCCCTCCTACTTTACCTATTGGGCACGCCAGGGATTGAAAGCAGGCTTTGTCTGGGGCTATCAAATCGGGGTGCCAGTTCCCCC
Full Trace Sequence: CCAGTAGTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGGGCTCGAACAGCGTGGAGATCCCTGGAGGAGGAACTGAAGGCTATCATGTCTTGCGGGTTCAAGAGAATTCCCCGGGACACAGAGCTGGCCTGGAGCCGTTCTTTGATTTTATTGTTTCTATCAATGGAATAAGGCTTAATAAAGATAATGACACACTTAAAGATCTGCTAAAAGCCAATGTGGAGAAGCCCGTAAAGATGGTGGTGTACAGCAGCAAGACACTGGAACTGAGGGAAACGACAGTGACGCCGAGTAATATGTGGGGTGGGCAAGGTTTACTGGGAGTCAGTATACGCTTCTGCAGCTTCGAAGGAGCAAATGAGAACGTATGGCATGTATTGGAGGTGGAACCAAACTCTCCTGCGGTACTGGCTGGGCTCAGACCCCACAGTGATTATATAATTGGAGCGGACACTGTAATGAATGAGTCTGAGGATCTATTCTCCCTCATTGAGACACATGAAGGAAAGCCTTTAAAACTTTATGTGTACAACACAGACACGGACAACTGTAGAGAGGTTGTCATCACGCCAAACACTGCATGGGGCTGGTGAGGGCAGTCTAGGGTGCGGAATCGGCTACGGTTACCTCCATCGGATACCAACAAGACCCTTTGAAGAGGGAAAGAATATCTCTTTGCCTGGACAAGTTCCAGGAGCCCCAGTGAGTCCTCTAAAAGATGGCTTTACAGAGGTACAGCTGTCGTCTGTAAATTTCCCCTCCTACTTTACCTATTGGGCACGCCAGGGATTGAAAGCAGGCTTTGTCTGGGGCTATCAAATCGGGGTGCCAGTTCCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGGGCTCGAACAG

Sequences - 3ʹ (reverse) EST

Accession: JZ829527
dbEST ID: 79647229
Trimmed Sequence: TGAAGATTCATTGGCGCTTGCTTCTGTGCTGCTAATAACAGGTTTCTCTGTGACGGGAAGGGTCGCATCTTCGGCAGGTGGAGTTACATGTTCTGTGGCGAGGGCCGGGGAATGGTCCAGCAATGGAGGAGGTATGTCACAAGCCATTGGTGCTAAAGGAAATGCAGGAAACTGAGAAGGAACTGACAGAGGTGGCATTCCTATCAGATTTAAAGGGGGCAATGGACCAAGGGACTGCAAACCTGCAACAGTTTGTGAAAGGTCTGTCAATCCTGGGTGTGGAATTAAGTGTGGAGCAGGCATGTTAATGTTGGGCAGATTCGGGAGGTTTGGCAGGTGAGGGAGTCCAGTGGATAATGGCATGATACTTGAAAGCGATACAGCTGGATTCAGAGCTACAGGGGTGAGAGATGGATTTATCTGTGGCGTGAGCACTGGCACAGTAGGTAAACCTGCATTAATCGCATTACTAACTAAAGGGGAACTGGCACCGATTGATAGCCCAGACAAGCTTGCTTCAATTCCTGCCGTGCCAATAGGTAAAGTAGGAGGGGAATTTACAGACGACAGCTGTACCTCTGTAAAGCCATCTTTTAGAGGACTCACTGGGGCTCCTGGAACTTGTCCAGGCAAAGAGATATTCTTTCCCTCTTCAAGGGGTCTTGTTG
Full Trace Sequence: CCGGCAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGAAGATTCATTGGCGCTTGCTTCTGTGCTGCTAATAACAGGTTTCTCTGTGACGGGAAGGGTCGCATCTTCGGCAGGTGGAGTTACATGTTCTGTGGCGAGGGCCGGGGAATGGTCCAGCAATGGAGGAGGTATGTCACAAGCCATTGGTGCTAAAGGAAATGCAGGAAACTGAGAAGGAACTGACAGAGGTGGCATTCCTATCAGATTTAAAGGGGGCAATGGACCAAGGGACTGCAAACCTGCAACAGTTTGTGAAAGGTCTGTCAATCCTGGGTGTGGAATTAAGTGTGGAGCAGGCATGTTAATGTTGGGCAGATTCGGGAGGTTTGGCAGGTGAGGGAGTCCAGTGGATAATGGCATGATACTTGAAAGCGATACAGCTGGATTCAGAGCTACAGGGGTGAGAGATGGATTTATCTGTGGCGTGAGCACTGGCACAGTAGGTAAACCTGCATTAATCGCATTACTAACTAAAGGGGAACTGGCACCGATTGATAGCCCAGACAAGCTTGCTTCAATTCCTGCCGTGCCAATAGGTAAAGTAGGAGGGGAATTTACAGACGACAGCTGTACCTCTGTAAAGCCATCTTTTAGAGGACTCACTGGGGCTCCTGGAACTTGTCCAGGCAAAGAGATATTCTTTCCCTCTTCAAGGGGTCTTGTTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGAAGATTCATTGGCGCTTG