ORFeome > gosr2 ORF1 – XORFeome v1.0

gosr2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: gosr2
Gene ID: 5869932
Gene Page ID: 5869910
ORF Xenbase ID: 17277633

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054249
Original XGC clone length: 633

Human orthology & disease relationships

NCBI Entrez ID: 9570
Ensembl gene IDs: ENSG00000108433,ENSG00000262633
Directly associated (OMIM) disease MIM numbers: 614018
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: H04

Sequences - 5ʹ (forward) EST

Accession: JZ839554
dbEST ID: 79657256
Trimmed Sequence: ATGGAGGCGCTTTATCACCAGAGTAACAAGCAGGTTCATGAGGTTCAGTCTCACATGGGTCTCCTGGAAACATCTGACAGACAGTCTGTACATCAGAATGAAATCCAATCGAGGATTGACCAAATCTTCAGCAACCTGGAGCGCCTGGAAATACTGTGCAGTAAGGAGCCCCCAAGCAAGCGTCAGAATGCCAAGCTACGAGTCGATCAGCTGAAGTACGATGTGCAGCATCTACAGACTGCGCTGAGGAACGTCCAGCATCGGCGCATCCTGCGAGACCAACAGGATCGAGAGCGAGAGGAGCTGCTGACCCGCAGTTACACCACCAATGATTCAGAGACCACCATACACATGGATGAGACCCTACAGTTTAATTCCAATATCCGTAATGCTCACCAAGGCATAGACGATCTGCTGGGGAGCGGGAGCTCTATACTGGAAGGGCTGAGGGACCAAAGGAAGACCTTAAAGGGGGCCCATAAGAAGATCCTTGATGTGGCCAACATGCTGGGCCTCTCTAACACAGTCATGCGCTTGATTGAGAAGAGAGCTTTCCAAGACAAGGTCATTATGATTGGTGGGATGCTGCTCACCTGCGTCTTCATGATCCTCGTGATCAAGTACCTGACATT
Full Trace Sequence: TCGAGGGCCATATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGCGCTTTATCACCAGAGTAACAAGCAGGTTCATGAGGTTCAGTCTCACATGGGTCTCCTGGAAACATCTGACAGACAGTCTGTACATCAGAATGAAATCCAATCGAGGATTGACCAAATCTTCAGCAACCTGGAGCGCCTGGAAATACTGTGCAGTAAGGAGCCCCCAAGCAAGCGTCAGAATGCCAAGCTACGAGTCGATCAGCTGAAGTACGATGTGCAGCATCTACAGACTGCGCTGAGGAACGTCCAGCATCGGCGCATCCTGCGAGACCAACAGGATCGAGAGCGAGAGGAGCTGCTGACCCGCAGTTACACCACCAATGATTCAGAGACCACCATACACATGGATGAGACCCTACAGTTTAATTCCAATATCCGTAATGCTCACCAAGGCATAGACGATCTGCTGGGGAGCGGGAGCTCTATACTGGAAGGGCTGAGGGACCAAAGGAAGACCTTAAAGGGGGCCCATAAGAAGATCCTTGATGTGGCCAACATGCTGGGCCTCTCTAACACAGTCATGCGCTTGATTGAGAAGAGAGCTTTCCAAGACAAGGTCATTATGATTGGTGGGATGCTGCTCACCTGCGTCTTCATGATCCTCGTGATCAAGTACCTGACATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAAAAGGTCACTATCAGTTCAATTAAAATCATTAATTGTCCATCCGCCTGATATCCCCTAATAGTGAATCCTAATAACTGGGTCAAAAACGTAGTTAAACAAGCAAAAAATGGAACAAGTAAACAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGCGCTTTATCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ839553
dbEST ID: 79657255
Trimmed Sequence: TGTCAGGTACTTGATCACGAGGATCATGAAGACGCAGGTGAGCAGCATCCCACCAATCATAATGACCTTGTCTTGGAAAGCTCTCTTCTCAATCAAGCGCATGACTGTGTTAGAGAGGCCCAGCATGTTGGCCACATCAAGGATCTTCTTATGGGCCCCCTTTAAGGTCTTCCTTTGGTCCCTCAGCCCTTCCAGTATAGAGCTCCCGCTCCCCAGCAGATCGTCTATGCCTTGGTGAGCATTACGGATATTGGAATTAAACTGTAGGGTCTCATCCATGTGTATGGTGGTCTCTGAATCATTGGTGGTGTAACTGCGGGTCAGCAGCTCCTCTCGCTCTCGATCCTGTTGGTCTCGCAGGATGCGCCGATGCTGGACGTTCCTCAGCGCAGTCTGTAGATGCTGCACATCGTACTTCAGCTGATCGACTCGTAGCTTGGCATTCTGACGCTTGCTTGGGGGCTCCTTACTGCACAGTATTTCCAGGCGCTCCAGGTTGCTGAAGATTTGGTCAATCCTCAATTGGATTTCATTCTGATGTACAGACTGTCTGTCAAATGTTTCCAGGAGACCCATGTCAGAATGAACCTCAAGAACCCGCTGTTACTCTTGTGAATAACCCCCCCCCTTGTGCCCACTTTTTTGTACAAGGTGGGCATTAATAAAAATCCTTTGCTCATCAATTTTGTTTCCACAAAAAAGTCTATTATTGATTCCAAAAAAAAAAAAAAAAAATATAAAAAAACAAAAAAAAAAAG
Full Trace Sequence: GGTATTCAGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGTCAGGTACTTGATCACGAGGATCATGAAGACGCAGGTGAGCAGCATCCCACCAATCATAATGACCTTGTCTTGGAAAGCTCTCTTCTCAATCAAGCGCATGACTGTGTTAGAGAGGCCCAGCATGTTGGCCACATCAAGGATCTTCTTATGGGCCCCCTTTAAGGTCTTCCTTTGGTCCCTCAGCCCTTCCAGTATAGAGCTCCCGCTCCCCAGCAGATCGTCTATGCCTTGGTGAGCATTACGGATATTGGAATTAAACTGTAGGGTCTCATCCATGTGTATGGTGGTCTCTGAATCATTGGTGGTGTAACTGCGGGTCAGCAGCTCCTCTCGCTCTCGATCCTGTTGGTCTCGCAGGATGCGCCGATGCTGGACGTTCCTCAGCGCAGTCTGTAGATGCTGCACATCGTACTTCAGCTGATCGACTCGTAGCTTGGCATTCTGACGCTTGCTTGGGGGCTCCTTACTGCACAGTATTTCCAGGCGCTCCAGGTTGCTGAAGATTTGGTCAATCCTCAATTGGATTTCATTCTGATGTACAGACTGTCTGTCAAATGTTTCCAGGAGACCCATGTCAGAATGAACCTCAAGAACCCGCTGTTACTCTTGTGAATAACCCCCCCCCTTGTGCCCACTTTTTTGTACAAGGTGGGCATTAATAAAAATCCTTTGCTCATCAATTTTGTTTCCACAAAAAAGTCTATTATTGATTCCAAAAAAAAAAAAAAAAAATATAAAAAAACAAAAAAAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTCAGGTACTTGATCACGAGG