ORFeome > gpam ORF1 – XORFeome v1.0

gpam ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gpam
Gene ID: 6254972
Gene Page ID: 6457153
ORF Xenbase ID: 17277675

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128670
Original XGC clone length: 2469

Human orthology & disease relationships

NCBI Entrez ID: 57678
Ensembl gene IDs: ENSG00000119927
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 208000,211980,222765,248600,268300,270200,307030,601003,601382,602475,608594,608643

Library Location

Plate ID: GDExl11087
Well Location: E10

Sequences - 5ʹ (forward) EST

Accession: JZ838129
dbEST ID: 79655831
Trimmed Sequence: ATGGAGGAAGCCGTTTGCTCCCTGGGGATGCCCGATGGCTACTACTTGCCCCATCCTGGGGATCACACGGGGGTGAAGCTGAAGAACTGCACAGAGGAGTGGGGGGAGAGGACACCCAGCCCGGCGGTGTTGCGGCCCGTCTTCCTGATCTGTAAAGAGACACTACCGATCACTATCAAACCGTTACAAGCCACATTCTGTCTCTCCCGACCTGCCCTCAACACCATTATGTATCTGGGGGTATTCCTCGTGCATTGGGAAAACATGGACTCTATTCTGTAACTGAGCTCCACTTTCCGACCTCAGATCGGCCGCCTGGAACTTCTCGACTTCATCCTGGGCTTTATGTTACC
Full Trace Sequence: GGCCCCAAATAATGGATTTTATTTTCGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGAAGCCGTTTGCTCCCTGGGGATGCCCGATGGCTACTACTTGCCCCATCCTGGGGATCACACGGGGGTGAAGCTGAAGAACTGCACAGAGGAGTGGGGGGAGAGGACACCCAGCCCGGCGGTGTTGCGGCCCGTCTTCCTGATCTGTAAAGAGACACTACCGATCACTATCAAACCGTTACAAGCCACATTCTGTCTCTCCCGACCTGCCCTCAACACCATTATGTATCTGGGGGTATTCCTCGTGCATTGGGAAAACATGGACTCTATTCTGTAACTGAGCTCCACTTTCCGACCTCAGATCGGCCGCCTGGAACTTCTCGACTTCATCCTGGGCTTTATGTTACCAACTTTCTTGTACGAATTTGGCATTATAACAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCATTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATCGTGAGTCGTATTACATGGTCATAACTGTTTCCTGGCAGCTCTGGCCCATGATCCGAATCTCATATGTTACAGCAAAACAGACTGACCGGATAAATTCTGTTATACCACAAAAAAACCTCGTTGTTTAACATAAGAATCACTAACCGCCAGGTGGGGATGGGCGGGTAAGGGTTCAGCGCACATTGCCCGCACAGGGCGCTCGGGCGGGTGGACAGGGGCGGGGTCAAAAAACGAGATACAAAGGTTGCGCGTGCTTGTGGGTGACGGGGAATCCCCACAAAATTCCAAGCCGGTATTTGGGTGGAGAAATGGGAAAACTTCTACTATTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGAAGCCGTTTGC

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GAAACCGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATAAAGCCCAGGATGAAGTCGAGAAGTTCCTGGCGGCTGCTTTGAGGTAGGAAAGTGGAGCTCAGTTCCAGAATAGAGTCCCTCTTTTCCTTATACACCTGGAATACCCCCAGATCCACAAAGGTCTTCACTGCATTTCGGGCGAGACACAAGGTGGCGCTTTCCGCATAGACAGCGACTGATCTTTCCGCTCTACAGATCAGGAACTTGAGGAGATTTTGGGTGAACTCCTTCTCTGGGACGGGGCTGCTGAAACTGAGGGTGAAGGTTGCGGCTGAACTATAAGCCTCCAGGATGGGGCCAATAATACCCTGCAGGAATGCCCAGAAATGCTGGTGCTTCCCCCATGGGGTCATCTTTTTTTAACGGACCTTCTGCTCTTCCCCAACATCGCTGTCCTCTTCCTCGCCACCAATTCGTCACGATCAATGTTCATACAGTCATTATTTCCACGGCTCACCCATCACACTGCGACTGGCATCTTCGGGCTTCCTCGCTCTGCTACCAGGAGAATCCCATAAGTGATGAGTCTCTGAACGGCCTCCTTGCAGACCTGGAAGAACATCTGACACGGGCAAAGCATGACCCCCTCATTTGGAGAGGAGGAAGCACAAGGCGGTGGCACTGCCGAACATGAACTCCCGGCCTGAAGGCTCCGTCGGAAAAAACCCGTTGTTTTCCCCGAGATTTTCCTCCCTCATTTGTGAGTTAAGGGGCGCCAGCCAACAACCTGCCCTCCTTGGAAATAAAACCTGGGAAGGAACCCCCGTTTGCTTTTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATAAAGCCCAGGATGAAGT