ORFeome > gpank1 ORF1 – XORFeome v1.0

gpank1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gpank1
Gene ID: 865461
Gene Page ID: 481265
ORF Xenbase ID: 17277681

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129062
Original XGC clone length: 1050

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: C04

Sequences - 5ʹ (forward) EST

Accession: JZ837489
dbEST ID: 79655191
Trimmed Sequence: ATGAATCATCTTCAGCTTATCACTTTCACAAAAGCCCGGGACAAATCGGATTATTGGGAGAATGGAGAGCACAGTAATAAAAAAGATCTCCATGCACCCAATGAAATTATAACAGGAGAGGAAGCCAGGAGCTTTTATGAAAGTCTTGTGGGAACTGAAAGACCGCAGCCTCACTCTAAAAAATCTTCTAGAAAACCAAAACCTGCCATATTGTCAGTACAGTCTCGTGAAACTGGTACCCAGTCAGAACAAAACACCTCCACAGCTCAGGATCCTAATGAGCAACGTAAAGGTCACCAGTTACTAAGGTGTTCTCAAGAAGGAGACTTGCGTGGGTTAAAAAGACTCGTGGAAAAAGAGAAGTGTAATATTAACTTTCATGACTCTTACTACTGGACAGCTCTAATGTGTGCGGCGTATGAAGGAAGAAAAGAAGTTGTTGGGTATTTGTTAGAGAGAGGTGCAGCTTGGGTAGGAGTATGTGACACTCAGGGAAGGGATGCTTTCTCATTGGCAGAGGAAGCTGGCCATGGAGACATCGTTCAGCTTCTTCAATCCTCCTTTACCTCTACNAAGAAGAGCATCGCAAGGAAAAGACCGTTGGAAAGAAAATACTGTGAAGTCTGCAAATCCCATTACCAGGAAGATACTCTTGAAACTCATGAACGCTCTACAGTTCACCTTTTCAATAACAAGAAGAAGCAGCCTGCTACTTATTATGCCATACCAGATCATAAACAAGGGGGTTAAAA
Full Trace Sequence: GAGGGCCCAAATAATGGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAATCATCTTCAGCTTATCACTTTCACAAAAGCCCGGGACAAATCGGATTATTGGGAGAATGGAGAGCACAGTAATAAAAAAGATCTCCATGCACCCAATGAAATTATAACAGGAGAGGAAGCCAGGAGCTTTTATGAAAGTCTTGTGGGAACTGAAAGACCGCAGCCTCACTCTAAAAAATCTTCTAGAAAACCAAAACCTGCCATATTGTCAGTACAGTCTCGTGAAACTGGTACCCAGTCAGAACAAAACACCTCCACAGCTCAGGATCCTAATGAGCAACGTAAAGGTCACCAGTTACTAAGGTGTTCTCAAGAAGGAGACTTGCGTGGGTTAAAAAGACTCGTGGAAAAAGAGAAGTGTAATATTAACTTTCATGACTCTTACTACTGGACAGCTCTAATGTGTGCGGCGTATGAAGGAAGAAAAGAAGTTGTTGGGTATTTGTTAGAGAGAGGTGCAGCTTGGGTAGGAGTATGTGACACTCAGGGAAGGGATGCTTTCTCATTGGCAGAGGAAGCTGGCCATGGAGACATCGTTCAGCTTCTTCAATCCTCCTTTACCTCTACNAAGAAGAGCATCGCAAGGAAAAGACCGTTGGAAAGAAAATACTGTGAAGTCTGCAAATCCCATTACCAGGAAGATACTCTTGAAACTCATGAACGCTCTACAGTTCACCTTTTCAATAACAAGAAGAAGCAGCCTGCTACTTATTATGCCATACCAGATCATAAACAAGGGGGTTAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATCATCTTCAGCTTATCACT

Sequences - 3ʹ (reverse) EST

Accession: JZ837488
dbEST ID: 79655190
Trimmed Sequence: AAAGTCAATATTCATGTAAGTTCGAAGATTCCTTTCCCAATCTCGCTCTTTTGCTTGCTTTCTCTTTTCGTCTTTTTTGCTGATTGTTGAGATTCTTTCTGTTCTCTTTTGTCTTATTTGCAAATTAGCAATGGCCATACTGTCATTGGCAGGAAAGTGCGTAACTTTAGGTTTTTGGTCTGTGTCGAAGCCAAGACCCTTTGTATCTCTCTTTAGAAGAGTCTTAACTGGGAATTTTCTCCCTTCTCCATCTGGTCCCAGCCCAGACTCTCGATTCCAGCCTTCCTTCAGCATCATCTTAAACCCCCTGTTATGATCTGGTATGGCATAATAAGTAGCAGGCTGCTTCTTCTTGTTATTGAAAAGGTGAACTGTAGAGCGTTCATGAGTTTCAAGAGTATCTTCCTGGTAATGGGATTTGCAGACTTCACAGTATTTTCTTTCCAACGGTCTTTTCCTTGCGATGCTCTTCTTTGTAGAGGTAAAGGAGGATTGAAAAAGCTGAACGATGTCTCCATGGCCAGCTTCCTCTGCCAATGAGAAAGCATCCCTTCCCTGAGTGTCGAATACTCCTACCCAACCTGCACCTCTCTCTAACAAAAACCCAACAACTTCTTTTCTTCTTTCCTACGCCCGCAAACATTAAAAGCTTTCAAGTAATAAAAATCCTGAAAAATTAAAAATTACAACTTCCCTTTTTTCCACCAAGTTTTTTTTTACCCCCACGCAAGTTCCCCCTTCCTTTAAAAAACAGCCCTTAG
Full Trace Sequence: GGGGAATAGTCTATGGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAAGTCAATATTCATGTAAGTTCGAAGATTCCTTTCCCAATCTCGCTCTTTTGCTTGCTTTCTCTTTTCGTCTTTTTTGCTGATTGTTGAGATTCTTTCTGTTCTCTTTTGTCTTATTTGCAAATTAGCAATGGCCATACTGTCATTGGCAGGAAAGTGCGTAACTTTAGGTTTTTGGTCTGTGTCGAAGCCAAGACCCTTTGTATCTCTCTTTAGAAGAGTCTTAACTGGGAATTTTCTCCCTTCTCCATCTGGTCCCAGCCCAGACTCTCGATTCCAGCCTTCCTTCAGCATCATCTTAAACCCCCTGTTATGATCTGGTATGGCATAATAAGTAGCAGGCTGCTTCTTCTTGTTATTGAAAAGGTGAACTGTAGAGCGTTCATGAGTTTCAAGAGTATCTTCCTGGTAATGGGATTTGCAGACTTCACAGTATTTTCTTTCCAACGGTCTTTTCCTTGCGATGCTCTTCTTTGTAGAGGTAAAGGAGGATTGAAAAAGCTGAACGATGTCTCCATGGCCAGCTTCCTCTGCCAATGAGAAAGCATCCCTTCCCTGAGTGTCGAATACTCCTACCCAACCTGCACCTCTCTCTAACAAAAACCCAACAACTTCTTTTCTTCTTTCCTACGCCCGCAAACATTAAAAGCTTTCAAGTAATAAAAATCCTGAAAAATTAAAAATTACAACTTCCCTTTTTTCCACCAAGTTTTTTTTTACCCCCACGCAAGTTCCCCCTTCCTTTAAAAAACAGCCCTTAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAAGTCAATATTCATGTAAGTTC