ORFeome > gpr143 ORF1 – XORFeome v1.0

gpr143 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gpr143
Gene ID: 5848682
Gene Page ID: 5848648
ORF Xenbase ID: 17277807

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123149
Original XGC clone length: 1203

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: G11

Sequences - 5ʹ (forward) EST

Accession: JZ838186
dbEST ID: 79655888
Trimmed Sequence: ATGGCTTCCCCCAGGCTGGAGACTTTCTGCTGCCCCAACAGGGATGCAGCTACACAGTTAGTGCTTGATTTCCAGCCTCAGGTCTATGGCTCGCTGTGTCTCGGCAGCGGCTTGGTGAGTCTCCTGCTGACCATTGTCCAGCTGTTGCCCAAGACAAAGCACGGCTACAGGAGGCACGGGAGATCCATGCTGCCAAAACCTTCTTCCTCCAGGATCTTGTTTCTAGTTATTGTCTGTGACCTACTGGGCTGCCTAGGAATTTTAATTCGATCATCGGTATGGATATCATCCCCAGGTTTCATTAGTAATATGTCACTAATGAATACTTCAGACATCTGGCCTTCAAGCTTTTGCGTTGGAAGTGCGATGTGGATACAGCTGTTTTACAGTGCAAGTTTCTGGTGGTTATTTTGCTATGCAATTGATGCTTACCTAGTTGTTCGCAGATCTGCAGGAATAAGCACAATTGTGTTGTATCACATGATGACGTGGGGCCTGGCACTTATGCTCTGCGTTGAAGGTGTGGCTATGCTTTACTATCCTTCAGTTTCCAATTGTGAAAATGGACTAGAACATGCAATTCCTCATTATGTCACAACCTATGCACCACTTCTTATCGTAATGTTTGCGAAATCCATCCTCTTTCCAAAAACAATTTGCAGCAATTGCT
Full Trace Sequence: CGAGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTTCCCCCAGGCTGGAGACTTTCTGCTGCCCCAACAGGGATGCAGCTACACAGTTAGTGCTTGATTTCCAGCCTCAGGTCTATGGCTCGCTGTGTCTCGGCAGCGGCTTGGTGAGTCTCCTGCTGACCATTGTCCAGCTGTTGCCCAAGACAAAGCACGGCTACAGGAGGCACGGGAGATCCATGCTGCCAAAACCTTCTTCCTCCAGGATCTTGTTTCTAGTTATTGTCTGTGACCTACTGGGCTGCCTAGGAATTTTAATTCGATCATCGGTATGGATATCATCCCCAGGTTTCATTAGTAATATGTCACTAATGAATACTTCAGACATCTGGCCTTCAAGCTTTTGCGTTGGAAGTGCGATGTGGATACAGCTGTTTTACAGTGCAAGTTTCTGGTGGTTATTTTGCTATGCAATTGATGCTTACCTAGTTGTTCGCAGATCTGCAGGAATAAGCACAATTGTGTTGTATCACATGATGACGTGGGGCCTGGCACTTATGCTCTGCGTTGAAGGTGTGGCTATGCTTTACTATCCTTCAGTTTCCAATTGTGAAAATGGACTAGAACATGCAATTCCTCATTATGTCACAACCTATGCACCACTTCTTATCGTAATGTTTGCGAAATCCATCCTCTTTCCAAAAACAATTTGCAGCAATTGCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTCCCCCAGGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838185
dbEST ID: 79655887
Trimmed Sequence: CCATCCTTGATATACAGGGGAGTTCCTGCTTAGTCGTTCCACTATACTCCCATTACCTTCAGATAGTATGCTCAAAGCCTCATCTGTTTGTTGACTGTTTCCAATTTCAGTCTTGTTTTGGTTCTGTATGTAGCCAGGGTAATCCAGGAAAGATCCATTGGTGCCATTGTGTGCAGCTTCAGTCAATGAAGATGTAGATACTCGTTCCCAAGCTGTTTCCTTTTGTCTGAAATTAAAGTCAACATTCCACCCTGTCCACCCGTAGAAAGCCAAAGTGAAGAGAAAGCCTTGCATTGGATTCAGTATACCCATTATAAACCATGTGATGAGTGCTGCATTCCTGACATTCTTTAGCTGATCCGTTTTGATGTCTGGCTGCATTTCCAGGTAGAACAAAAGAGTCTCATTGATAATATTAGCTGTCCAACAGATCATAAACACCAACATGATCTTGAAAAAACGGAGTTGAATTTCTGTCCCCAGCCGTCTTTCATTCTCTGTATAAATTCCTTGTCTTCCTTTCAGTAAAGAAGCAACTGCTGCAACTGTTCTTCGAAAGAGGATTGGATTCGCAAACATTACGATAAGAAGTGGTGCATAGGTTGTGACATAATGAGGAATTTGCATGTTCTAGTCCATTTTCACCATTGGAAACTTAAAGGATAATAAAGCATAACCACCCCCTTCAACGCCAAAACAATAAATTGCCAGGGCCCCACGGTCTACATGTTTATACCAACACAAATTTGGGG
Full Trace Sequence: GAGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCATCCTTGATATACAGGGGAGTTCCTGCTTAGTCGTTCCACTATACTCCCATTACCTTCAGATAGTATGCTCAAAGCCTCATCTGTTTGTTGACTGTTTCCAATTTCAGTCTTGTTTTGGTTCTGTATGTAGCCAGGGTAATCCAGGAAAGATCCATTGGTGCCATTGTGTGCAGCTTCAGTCAATGAAGATGTAGATACTCGTTCCCAAGCTGTTTCCTTTTGTCTGAAATTAAAGTCAACATTCCACCCTGTCCACCCGTAGAAAGCCAAAGTGAAGAGAAAGCCTTGCATTGGATTCAGTATACCCATTATAAACCATGTGATGAGTGCTGCATTCCTGACATTCTTTAGCTGATCCGTTTTGATGTCTGGCTGCATTTCCAGGTAGAACAAAAGAGTCTCATTGATAATATTAGCTGTCCAACAGATCATAAACACCAACATGATCTTGAAAAAACGGAGTTGAATTTCTGTCCCCAGCCGTCTTTCATTCTCTGTATAAATTCCTTGTCTTCCTTTCAGTAAAGAAGCAACTGCTGCAACTGTTCTTCGAAAGAGGATTGGATTCGCAAACATTACGATAAGAAGTGGTGCATAGGTTGTGACATAATGAGGAATTTGCATGTTCTAGTCCATTTTCACCATTGGAAACTTAAAGGATAATAAAGCATAACCACCCCCTTCAACGCCAAAACAATAAATTGCCAGGGCCCCACGGTCTACATGTTTATACCAACACAAATTTGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCATCCTTGATATACAGGGGAGTT