ORFeome > gpr160 ORF1 – XORFeome v1.0

gpr160 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gpr160
Gene ID: 980189
Gene Page ID: 980182
ORF Xenbase ID: 17277831

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC046372
Original XGC clone length: 972

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11012
Well Location: E09

Sequences - 5ʹ (forward) EST

Accession: JZ823995
dbEST ID: 79641697
Trimmed Sequence: ATGGAGGTAGAAGTGTATGAGCCCAGCTGTTTACTGATACTGATCATAACTGGCAAGATCATAATGAATATATTTATTTTTGGGGCCAGACGCAGGAAAGTCCACACAAGCTTCCTGGGATGCTTCTGTGTCTCGTTGGGTGTTTTGGACTTTGCCCTTTTGGTTACCACTTCAGTTATCCATTATTTCCAGGACTTTGCTATTTGTGGCATGAGGTTCACTAACTATCACATCTGCCTGTTTACTCAGATCATATCCCATGCGTATGGCATTCTGCACTATCCAGCCCTATTAACAGCAGGGCTAGATTATTACATTAGTGTTGTTAAATCCGTTAATCTCCACAGGTTTTCTCTTGGCTTCCTGCACGTGTTACTTACCCTGCTCCTGTGGATGGCAGCACTTTCCTTTGCCCTCTATTCTTCTGTTCCTCCTCCAGCCTCAGGCCCTGGACTGTCCTCATACCAGTGCACTTTCTATGTCAGCAGCCAGACTTACTATTTATCAGCCGCAGTGGTGTGTACCATTGTATTGATTCTGGGAATATGTTGCTTTGAAGTGGTGGCTTTCATAAAGTCCATGAAGCTCATCTCCTTCACCAACAAGACTGTCCTGCTGTTTTCCTGTGGAGACAAGTGGCCTATCCAAGGAACTAGACGTCTCTTTACAGCTCTTGTGTTCTCATTTCTGGGCACTTGGGCTCCATATGTCCTCCTTCAANNATATCTCCNTTATTTTGTGTGCTCCAATCCCGGGTTACATTGGACATGTAAGGTGGGCTTGGCTTTTATTTTATG
Full Trace Sequence: CAATAATGATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGTAGAAGTGTATGAGCCCAGCTGTTTACTGATACTGATCATAACTGGCAAGATCATAATGAATATATTTATTTTTGGGGCCAGACGCAGGAAAGTCCACACAAGCTTCCTGGGATGCTTCTGTGTCTCGTTGGGTGTTTTGGACTTTGCCCTTTTGGTTACCACTTCAGTTATCCATTATTTCCAGGACTTTGCTATTTGTGGCATGAGGTTCACTAACTATCACATCTGCCTGTTTACTCAGATCATATCCCATGCGTATGGCATTCTGCACTATCCAGCCCTATTAACAGCAGGGCTAGATTATTACATTAGTGTTGTTAAATCCGTTAATCTCCACAGGTTTTCTCTTGGCTTCCTGCACGTGTTACTTACCCTGCTCCTGTGGATGGCAGCACTTTCCTTTGCCCTCTATTCTTCTGTTCCTCCTCCAGCCTCAGGCCCTGGACTGTCCTCATACCAGTGCACTTTCTATGTCAGCAGCCAGACTTACTATTTATCAGCCGCAGTGGTGTGTACCATTGTATTGATTCTGGGAATATGTTGCTTTGAAGTGGTGGCTTTCATAAAGTCCATGAAGCTCATCTCCTTCACCAACAAGACTGTCCTGCTGTTTTCCTGTGGAGACAAGTGGCCTATCCAAGGAACTAGACGTCTCTTTACAGCTCTTGTGTTCTCATTTCTGGGCACTTGGGCTCCATATGTCCTCCTTCAANNATATCTCCNTTATTTTGTGTGCTCCAATCCCGGGTTACATTGGACATGTAAGGTGGGCTTGGCTTTTATTTTATG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGTAGAAGTGTATGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ829303
dbEST ID: 79647005
Trimmed Sequence: AACGATCATAAATGGATGTAACTGCTCCTTTAAATAATCTTCCACTTTGTAGTCCATGTCAATAAAAGGCAGAATGCAATATTTCCAGCTGATGAAAGGGTCTATGGAAAAGGTCTCTCTGGTCAGGTCAATGCGAGGATACGCAAGGCCATAGGCCATTCCCACAAGAAAGCTGTTCATAAAATAAAGCCAAGCCACATTCATGTCCATGTAACCCGGGATTGGAGCACACAAAATAAGGAGAATAATTTGAAGGAGGACATATGGAGCCCAAGTGCCCAGAAATGAGAACACAAGAGCTGTAAAGAGACGTCTAGTTCCTTGGATAGGCCACTTGTCTCCACAGGAAAACAGCAGGACAGTCTTGTTGGTGAAGGAGATGAGCTTCATGGACTTTATGAAAGCCACCACTTCAAAGCAACATATTCCCAGAATCAATACAATGGTACACACCACTGCGGCTGATAAATAGTAAGTCTGGCTGCTGACATAGAAAGTGCACTGGTATGAGGACAGTCCAGGGCCTGAGGCTGGAGGAGGAACAGAAGAATAGAGGGCAAAAGAAAGTGCTGCCATCCACAGGAGCAGGGTAAGTAACACGTGCAAGGAGCCAAGAAAAAAACCTGTGGAAAATTAACGGAATTTAACAACCCTAATGTTATAAATCTTACCCCTGGCTGTTAATAGGGGGCTGGATAATGGCAAAAATGGCCATAACCCCAGGGGAAAATTAATTTTTAAATTAAAACAGGGGAAAAAA
Full Trace Sequence: TTGACAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAACGATCATAAATGGATGTAACTGCTCCTTTAAATAATCTTCCACTTTGTAGTCCATGTCAATAAAAGGCAGAATGCAATATTTCCAGCTGATGAAAGGGTCTATGGAAAAGGTCTCTCTGGTCAGGTCAATGCGAGGATACGCAAGGCCATAGGCCATTCCCACAAGAAAGCTGTTCATAAAATAAAGCCAAGCCACATTCATGTCCATGTAACCCGGGATTGGAGCACACAAAATAAGGAGAATAATTTGAAGGAGGACATATGGAGCCCAAGTGCCCAGAAATGAGAACACAAGAGCTGTAAAGAGACGTCTAGTTCCTTGGATAGGCCACTTGTCTCCACAGGAAAACAGCAGGACAGTCTTGTTGGTGAAGGAGATGAGCTTCATGGACTTTATGAAAGCCACCACTTCAAAGCAACATATTCCCAGAATCAATACAATGGTACACACCACTGCGGCTGATAAATAGTAAGTCTGGCTGCTGACATAGAAAGTGCACTGGTATGAGGACAGTCCAGGGCCTGAGGCTGGAGGAGGAACAGAAGAATAGAGGGCAAAAGAAAGTGCTGCCATCCACAGGAGCAGGGTAAGTAACACGTGCAAGGAGCCAAGAAAAAAACCTGTGGAAAATTAACGGAATTTAACAACCCTAATGTTATAAATCTTACCCCTGGCTGTTAATAGGGGGCTGGATAATGGCAAAAATGGCCATAACCCCAGGGGAAAATTAATTTTTAAATTAAAACAGGGGAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACGATCATAAATGGATGTAACTG