ORFeome > gpx7 ORF1 – XORFeome v1.0

gpx7 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gpx7
Gene ID: 940920
Gene Page ID: 940914
ORF Xenbase ID: 17277921

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC088790
Original XGC clone length: 555

Human orthology & disease relationships

NCBI Entrez ID: 2882
Ensembl gene IDs: ENSG00000116157
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 108120,182290,203500,215600,230450,231900,266130,273750,607748,607841,609285

Library Location

Plate ID: GDExl11078
Well Location: E12

Sequences - 5ʹ (forward) EST

Accession: JZ836612
dbEST ID: 79654314
Trimmed Sequence: ATGTACTTCGCGGCTCTCGTTCTGCTTCTCTCGTTGTCCCCCTCACTGCAGAAATCCCGGGATTTCTACACGTTTAAGGTGGTAAATATCAGGGGCAAGCTGGTGTCGCTGGAGAAGTACCGTGGTTCGGTGTCTCTGGTGGTCAATGTAGCAAGTGAGTGTGGATATACAGACTCTCACTACAAAGCATTGCAGCAACTGCAGAGGGACTTGGGTTCTCACCACTTCAATGTTTTGGCATTTCCATGCAACCAGTTTGGACAACAGGAACCAAATAGTGATCGAGAAATTGAGAACTTTATCAGAAAGAATTACAGTGTATCCTTTCCCATGTTCAGCAAAACTGCAGTCACTGGCTCTGGTGCCAATACTGCCTTCAAGTACCTAATCGAATCCTCTGGAAAAGAACCGGACTGGAATTTCTGGAAATACTTGGTTGGGCCAGATGGTAAAGTAGTTGATGCTTGGGGTCCAACAATCTCTGTAGCAGAGGTGAGGCCTCACGTCACAAGTCTTGTGAGGAAAATAATTCTGAAGAAGAAAGAAGAACTTTT
Full Trace Sequence: GAGTTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTACTTCGCGGCTCTCGTTCTGCTTCTCTCGTTGTCCCCCTCACTGCAGAAATCCCGGGATTTCTACACGTTTAAGGTGGTAAATATCAGGGGCAAGCTGGTGTCGCTGGAGAAGTACCGTGGTTCGGTGTCTCTGGTGGTCAATGTAGCAAGTGAGTGTGGATATACAGACTCTCACTACAAAGCATTGCAGCAACTGCAGAGGGACTTGGGTTCTCACCACTTCAATGTTTTGGCATTTCCATGCAACCAGTTTGGACAACAGGAACCAAATAGTGATCGAGAAATTGAGAACTTTATCAGAAAGAATTACAGTGTATCCTTTCCCATGTTCAGCAAAACTGCAGTCACTGGCTCTGGTGCCAATACTGCCTTCAAGTACCTAATCGAATCCTCTGGAAAAGAACCGGACTGGAATTTCTGGAAATACTTGGTTGGGCCAGATGGTAAAGTAGTTGATGCTTGGGGTCCAACAATCTCTGTAGCAGAGGTGAGGCCTCACGTCACAAGTCTTGTGAGGAAAATAATTCTGAAGAAGAAAGAAGAACTTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATTCCCTATAGTGAGTCGTATTACCTGGGTCATAGCTTGTTTCCAGGCAACATCTGCCCGTGTCTAAAATTCCCTTGAAAGTTAAAAAACCGAGAAAAAAAAAAAACTTTCCCTCAGGCCACCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTACTTCGCGGCTCTCGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ836613
dbEST ID: 79654315
Trimmed Sequence: AAGTTCTTCTTTCTTCTTCAGAATTATTTTCCTCACAAGACTTGTGACGTGAGGCCTCACCTCTGCTACAGAGATTGTTGGACCCCAAGCATCAACTACTTTACCATCTGGCCCAACCAAGTATTTCCAGAAATTCCAGTCCGGTTCTTTTCCAGAGGATTCGATTAGGTACTTGAAGGCAGTATTGGCACCAGAGCCAGTGACTGCAGTTTTGCTGAACATGGGAAAGGATACACTGTAATTCTTTCTGATAAAGTTCTCAATTTCTCGATCACTATTTGGTTCCTGTTGTCCAAACTGGTTGCATGGAAATGCCAAAACATTGAAGTGGTGAGAACCCAAGTCCCTCTGCAGTTGCTGCAATGCTTTGTAGTGAGAGTCTGTATATCCACACTCACTTGCTACATTGACCACCAGAGACACCGAACCACGGTACTTCTCCAGCGACACCAGCTTGCCCCTGATATTTACCACCTTAAACGTGTAGAAATCCCGGGATTTCTGCAGTGAGGGGGACAACGAGAGAAGCAGAACGAGAGCCGCGAAGTACATGG
Full Trace Sequence: TGGCAGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGTTCTTCTTTCTTCTTCAGAATTATTTTCCTCACAAGACTTGTGACGTGAGGCCTCACCTCTGCTACAGAGATTGTTGGACCCCAAGCATCAACTACTTTACCATCTGGCCCAACCAAGTATTTCCAGAAATTCCAGTCCGGTTCTTTTCCAGAGGATTCGATTAGGTACTTGAAGGCAGTATTGGCACCAGAGCCAGTGACTGCAGTTTTGCTGAACATGGGAAAGGATACACTGTAATTCTTTCTGATAAAGTTCTCAATTTCTCGATCACTATTTGGTTCCTGTTGTCCAAACTGGTTGCATGGAAATGCCAAAACATTGAAGTGGTGAGAACCCAAGTCCCTCTGCAGTTGCTGCAATGCTTTGTAGTGAGAGTCTGTATATCCACACTCACTTGCTACATTGACCACCAGAGACACCGAACCACGGTACTTCTCCAGCGACACCAGCTTGCCCCTGATATTTACCACCTTAAACGTGTAGAAATCCCGGGATTTCTGCAGTGAGGGGGACAACGAGAGAAGCAGAACGAGAGCCGCGAAGTACATGGTGCCAACTTTTTTGTAAAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTTTTGCAACGAAAAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGGCCCAAGGATAAAAACTGGCCGTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGTTCTTCTTTCTTCTTCAGAAT