ORFeome > gsta1 ORF1 – XORFeome v1.0

gsta1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gsta1
Gene ID: 966113
Gene Page ID: 966108
ORF Xenbase ID: 17278077

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129660
Original XGC clone length: 663

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: D05

Sequences - 5ʹ (forward) EST

Accession: JZ837866
dbEST ID: 79655568
Trimmed Sequence: ATGGCTGAAAAACCTGTACTGCACTATTTTAATGGAAGAGGGCGCATGGAGTCAATCAGGTGGCTGTTGGCTGCAGCTGGAGTTGAGTTTGATGAACAATATATTGAAACAAGGGAACAATATGAACAGCTACTTAAAGATGGAAGTTTGATGTTCGAACAGGTTCCTCTGGTTCAAATGGATGGGATGAATCTGATACAAATTAAAGCCATTTTATCTTACATTGCTGGAAAATACAACATGTACGGAAAGGACCTGAAGGAGAGACTTTTTATTGACATGTATGTAGATGGCACAGGTGACCTTTTGAGTCTTGGTACGGTCTATGTCTTTCTTGATGATGCTGGCAAGGAAAAACAAAAAGCAAATATTAAGGAAAAAGCAACAAAAAGATATTTTCCAATATATGAAAAGGTTTTGAAAGATCAGCACTATCTTGTTGGGAACAAGTTTAGCTGGGCAGATGTACAATTAATGGAAACCATTTTAATGACAGAAGAGTTCCACAGTGACATCCTATCCTGCTTTCCTAACCTGAAAGAATTCAAAGAGAGGAAAAAGCAAAATACCCCAATTTCAAAGTTTCTTCAGCCTGGAAAGTCCAAGAAACCTTTTTCAGACTTGAAAAATTTAACGCCTGTGAAAAATGTTCTAAAAAATTTTGCCAACTTCCTTGGCCAACGTTGGGCTTTATAAGAAGAGCATTTCCTAATAAGTTGTGTTCCTACTATGGGGGGCGAAGTGGAATCAAAAAAAAAATCAATTATTTTTATCTTCCGCGCTTAATAGGCGCGCCCGTGNNNTGAAAAAAAAAAAAAAAAAA
Full Trace Sequence: TCGAGGGCCCAATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGAAAAACCTGTACTGCACTATTTTAATGGAAGAGGGCGCATGGAGTCAATCAGGTGGCTGTTGGCTGCAGCTGGAGTTGAGTTTGATGAACAATATATTGAAACAAGGGAACAATATGAACAGCTACTTAAAGATGGAAGTTTGATGTTCGAACAGGTTCCTCTGGTTCAAATGGATGGGATGAATCTGATACAAATTAAAGCCATTTTATCTTACATTGCTGGAAAATACAACATGTACGGAAAGGACCTGAAGGAGAGACTTTTTATTGACATGTATGTAGATGGCACAGGTGACCTTTTGAGTCTTGGTACGGTCTATGTCTTTCTTGATGATGCTGGCAAGGAAAAACAAAAAGCAAATATTAAGGAAAAAGCAACAAAAAGATATTTTCCAATATATGAAAAGGTTTTGAAAGATCAGCACTATCTTGTTGGGAACAAGTTTAGCTGGGCAGATGTACAATTAATGGAAACCATTTTAATGACAGAAGAGTTCCACAGTGACATCCTATCCTGCTTTCCTAACCTGAAAGAATTCAAAGAGAGGAAAAAGCAAAATACCCCAATTTCAAAGTTTCTTCAGCCTGGAAAGTCCAAGAAACCTTTTTCAGACTTGAAAAATTTAACGCCTGTGAAAAATGTTCTAAAAAATTTTGCCAACTTCCTTGGCCAACGTTGGGCTTTATAAGAAGAGCATTTCCTAATAAGTTGTGTTCCTACTATGGGGGGCGAAGTGGAATCAAAAAAAAAATCAATTATTTTTATCTTCCGCGCTTAATAGGCGCGCCCGTGNNNTGAAAAAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGAAAAACCTGTACTG

Sequences - 3ʹ (reverse) EST

Accession: JZ837865
dbEST ID: 79655567
Trimmed Sequence: CATATTAAGAACAGTCTTCACAGTGGTCACATATTTCATGTCTGGAAAAGGTTTCTTTGGACTTCCAGGCTGAAGGAACTTTGCAATTGTTGGTATTTGCTTTATTCTCTCTTTGAAGTCCTTCAGGTTAGGAAAGCAGGATAGGATGTCACTGTGGAACTCTTCTGTCATTAAAATGACTTCCATTAATTGTACATCTGCCCAGCTAAACTTGTTCCCAACAAGATAGTGCTGATCTTTCAAAACCTTTTCATATATTGGAAAATATCTTTTTGTTGCTTTTTCCTTAATATTTGCTTTTTGTTTTTCCTTGCCAGCATCATCAAGAAAAACATAGACCGTACCAAGACTCACAAAGTCGCCTGTGCCATCTACATACTTGTCAATAAAAAGTCTCTCCTTCAGGTCCTTTCCGTACGTGTTGTATTTTCCAGCGATGTAAGAATAAATGGCTGTGATTTGTATCAAATTCATCCCATCCATTTGAACCACAGGAACCAGTTCGAACCTCAAACTTCCATCTTTAATTACCTGTTCATATAGTTCCGGTGTTTCGGTATATTGTTCATCAAACTCAACTTCAGCCTGCAACCAGCAGAGACCTGATTGACACGAGGCACCCGTCTTCATTTAAAGTGTGCAGTACAAGATTTTGCACCCTGGTACGGACGGGTTGGTTACAGAATGCCATGGGAGAAAACAATGCTGATCGATTTGTTTCAACGAACAGGTCACTATGGTTCAAAAAAAAAACATTAATTGGGGAAAAAAGAAGAAAAAAAAAAAAAAAGAAGAGAGGAATATAAAAGGAGAGGGGGGGGGGGGAGAGGAGGGGGATGAGGGGGGGGGGGNGGGTAGGAGGGGGGGNNGNGGGGGANGAGNAAAGAGAAGAGGAGAGGGGAAGAGGGAGANGGGGGGGGGNGGGGGGGGGGGGAGAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAGAAGAANGANNNNNGAGNNGAGNGAGGGGGNGGAGAGAAAAAAAAAAAAAAAAAAGAAAAGGAAAAAAAAAAAAAAAAAAAGAAAAGAGGAGGAGAANGAAGGAGGGGAGGTGAGGGAAGANGNGAGNGNNAAGGGGAGGGAAGNGAGAAAAGAGGNGGANGGGGGAGAANGGNNGGNNNGGGAGGGGAGGGGNAGGGGAGNGAGGGNNGGGGNAGANAGAGAAGGAAAAAAGGAAGAGAANAAGGGGAAGGGAGGNGAGNAGGANNAGGGANNGG
Full Trace Sequence: GGGCCGGGCATCAGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATATTAAGAACAGTCTTCACAGTGGTCACATATTTCATGTCTGGAAAAGGTTTCTTTGGACTTCCAGGCTGAAGGAACTTTGCAATTGTTGGTATTTGCTTTATTCTCTCTTTGAAGTCCTTCAGGTTAGGAAAGCAGGATAGGATGTCACTGTGGAACTCTTCTGTCATTAAAATGACTTCCATTAATTGTACATCTGCCCAGCTAAACTTGTTCCCAACAAGATAGTGCTGATCTTTCAAAACCTTTTCATATATTGGAAAATATCTTTTTGTTGCTTTTTCCTTAATATTTGCTTTTTGTTTTTCCTTGCCAGCATCATCAAGAAAAACATAGACCGTACCAAGACTCACAAAGTCGCCTGTGCCATCTACATACTTGTCAATAAAAAGTCTCTCCTTCAGGTCCTTTCCGTACGTGTTGTATTTTCCAGCGATGTAAGAATAAATGGCTGTGATTTGTATCAAATTCATCCCATCCATTTGAACCACAGGAACCAGTTCGAACCTCAAACTTCCATCTTTAATTACCTGTTCATATAGTTCCGGTGTTTCGGTATATTGTTCATCAAACTCAACTTCAGCCTGCAACCAGCAGAGACCTGATTGACACGAGGCACCCGTCTTCATTTAAAGTGTGCAGTACAAGATTTTGCACCCTGGTACGGACGGGTTGGTTACAGAATGCCATGGGAGAAAACAATGCTGATCGATTTGTTTCAACGAACAGGTCACTATGGTTCAAAAAAAAAACATTAATTGGGGAAAAAAGAAGAAAAAAAAAAAAAAAGAAGAGAGGAATATAAAAGGAGAGGGGGGGGGGGGAGAGGAGGGGGATGAGGGGGGGGGGGNGGGTAGGAGGGGGGGNNGNGGGGGANGAGNAAAGAGAAGAGGAGAGGGGAAGAGGGAGANGGGGGGGGGNGGGGGGGGGGGGAGAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAGAAGAANGANNNNNGAGNNGAGNGAGGGGGNGGAGAGAAAAAAAAAAAAAAAAAAGAAAAGGAAAAAAAAAAAAAAAAAAAGAAAAGAGGAGGAGAANGAAGGAGGGGAGGTGAGGGAAGANGNGAGNGNNAAGGGGAGGGAAGNGAGAAAAGAGGNGGANGGGGGAGAANGGNNGGNNNGGGAGGGGAGGGGNAGGGGAGNGAGGGNNGGGGNAGANAGAGAAGGAAAAAAGGAAGAGAANAAGGGGAAGGGAGGNGAGNAGGANNAGGGANNGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATATTAAGAACAGTCTTCACAGT