ORFeome > gstm1 ORF1 – XORFeome v1.0

gstm1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: gstm1
Gene ID: 971390
Gene Page ID: 971383
ORF Xenbase ID: 17278101

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054171
Original XGC clone length: 660

Human orthology & disease relationships

NCBI Entrez ID: 2944
Ensembl gene IDs: ENSG00000134184
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101600,104300,105120,108120,115200,123500,125853,131950,145980,151660,159001,176670,181350,182290,184500,211980,215600,226650,226670,230450,231900,245050,248370,266130,600652,603278,604219,604929,605588,606054,606595,607748,607841,607920,608056,609015,609285

Library Location

Plate ID: GDExl11001
Well Location: B11

Sequences - 5ʹ (forward) EST

Accession: JZ839148
dbEST ID: 79656850
Trimmed Sequence: ATGGTGGTGATACTAGGATACTGGGACATCAGAGGGTTGGCTCATTCTATCCGTCTCCTGCTTGAATACACAGGCACGCAATACGAAGAAAAACTTTATGTAACAGGGGATGCCCCCAATTATGATAAGAGCCAGTGGCTGAATGAAAAAGAGAAGCTGGGATTGGACTTTCCCAATTTACCATACCTCGTGGATGGTGATGTGAAGCTTACACAGAGTAATGCAATTCTTCGCTATATTGCACGCAAGCATGGACTTTGTGGAGAGTCAGAGAAAGAAAAGAACTATGTTGATCTAATAGAAAATCAAGCGATGGATTTTCGCATGGGTCTTGTTGTAATTGCTTACAGTCCTCAATTTGAAACACTGAAGGGGCCATATTTAGAGAAGCTGCCTATTGCTCTGAAAAAGTTCTCTTGCTTTCTAGGAGATAGATCTTGGTTTGCAGGAGATAAGATCACTTATGTCGATTTCGTGATGTATGATGTACTAGATCAACACCGGATATTAGATCCAACTTGTCTGCAGAATTTTAAGAATTTGCAGGCCTTTCTAACCCGATTTGAGGCCCTCCCTGCTATTGATGCTTACATGAAGTCCTCGCGTTTTATGAAAACACCGATTAACAACCGCATGGCATCCTGGGGCAACAAAAAATT
Full Trace Sequence: CTCGTGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGGTGATACTAGGATACTGGGACATCAGAGGGTTGGCTCATTCTATCCGTCTCCTGCTTGAATACACAGGCACGCAATACGAAGAAAAACTTTATGTAACAGGGGATGCCCCCAATTATGATAAGAGCCAGTGGCTGAATGAAAAAGAGAAGCTGGGATTGGACTTTCCCAATTTACCATACCTCGTGGATGGTGATGTGAAGCTTACACAGAGTAATGCAATTCTTCGCTATATTGCACGCAAGCATGGACTTTGTGGAGAGTCAGAGAAAGAAAAGAACTATGTTGATCTAATAGAAAATCAAGCGATGGATTTTCGCATGGGTCTTGTTGTAATTGCTTACAGTCCTCAATTTGAAACACTGAAGGGGCCATATTTAGAGAAGCTGCCTATTGCTCTGAAAAAGTTCTCTTGCTTTCTAGGAGATAGATCTTGGTTTGCAGGAGATAAGATCACTTATGTCGATTTCGTGATGTATGATGTACTAGATCAACACCGGATATTAGATCCAACTTGTCTGCAGAATTTTAAGAATTTGCAGGCCTTTCTAACCCGATTTGAGGCCCTCCCTGCTATTGATGCTTACATGAAGTCCTCGCGTTTTATGAAAACACCGATTAACAACCGCATGGCATCCTGGGGCAACAAAAAATTGCCAACTTTCTTGTACAAAGTTTGGATTATAAGAAACCATTTCTTAATTATTTTTTTGGAAACAAAAAGGTCACCTATCAGTTCAAAATAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGGTGATACTAGGATACTG

Sequences - 3ʹ (reverse) EST

Accession: JZ839147
dbEST ID: 79656849
Trimmed Sequence: TTTTTTGTTGCCCCAGGATGCCATGCGGTTGTTAATCGGTGTCTTCATAAAACGCGAGGACTTCATGTAAGCATCAATAGCAGGGAGGGCCTCAAATCGGGTTAGAAAGGCCTGCAAATTCTTAAAATTCTGCAGACAAGTTGGATCTAATATCCGGTGTTGATCTAGTACATCATACATCACGAAATCGACATAAGTGATCTTATCTCCTGCAAACCAAGATCTATCTCCTAGAAAGCAAGAGAACTTTTTCAGAGCAATAGGCAGCTTCTCTAAATATGGCCCCTTCAGTGTTTCAAATTGAGGACTGTAAGCAATTACAACAAGACCCATGCGAAAATCCATCGCTTGATTTTCTATTAGATCAACATAGTTCTTTTCTTTCTCTGACTCTCCACAAAGTCCATGCTTGCGTGCAATATAGCGAAGAATTGCATTACTCTGTGTAAGCTTCACATCACCATCCACGAGGTATGGTAAATTGGGAAAGTCCAATCCCAGCTTCTCTTTTTCATTCAGCCACTGGCTCTTATCATAATTGGGGGCATCCCCTGGTACATAAAGTTTTTCTTCGTATTGCGTGGCTGTGTATTCAAGCAAGAAACGGATAAAAGGAGCCCACCCTCCGATGTCCCATTATCCTAATATCACCCCAATGGTGCCC
Full Trace Sequence: GACGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTTTTGTTGCCCCAGGATGCCATGCGGTTGTTAATCGGTGTCTTCATAAAACGCGAGGACTTCATGTAAGCATCAATAGCAGGGAGGGCCTCAAATCGGGTTAGAAAGGCCTGCAAATTCTTAAAATTCTGCAGACAAGTTGGATCTAATATCCGGTGTTGATCTAGTACATCATACATCACGAAATCGACATAAGTGATCTTATCTCCTGCAAACCAAGATCTATCTCCTAGAAAGCAAGAGAACTTTTTCAGAGCAATAGGCAGCTTCTCTAAATATGGCCCCTTCAGTGTTTCAAATTGAGGACTGTAAGCAATTACAACAAGACCCATGCGAAAATCCATCGCTTGATTTTCTATTAGATCAACATAGTTCTTTTCTTTCTCTGACTCTCCACAAAGTCCATGCTTGCGTGCAATATAGCGAAGAATTGCATTACTCTGTGTAAGCTTCACATCACCATCCACGAGGTATGGTAAATTGGGAAAGTCCAATCCCAGCTTCTCTTTTTCATTCAGCCACTGGCTCTTATCATAATTGGGGGCATCCCCTGGTACATAAAGTTTTTCTTCGTATTGCGTGGCTGTGTATTCAAGCAAGAAACGGATAAAAGGAGCCCACCCTCCGATGTCCCATTATCCTAATATCACCCCAATGGTGCCCAATTTTTTTGTACAAGTTTGGGAATTATAAAAAAACATTTGCTCATCAATTTGGTTGCAACGAAAAAGGTTCCACTATCAGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTTTGTTGCCCCAGGATG