ORFeome > gsto2 ORF1 – XORFeome v1.0

gsto2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gsto2
Gene ID: 967233
Gene Page ID: 967226
ORF Xenbase ID: 17278113

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC153757
Original XGC clone length: 726

Human orthology & disease relationships

NCBI Entrez ID: 119391
Ensembl gene IDs: ENSG00000065621
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 215600,230450,231900,266130,607748

Library Location

Plate ID: GDExl11093
Well Location: B03

Sequences - 5ʹ (forward) EST

Accession: JZ839034
dbEST ID: 79656736
Trimmed Sequence: ATGACTGGATCGGAGAAGTGTTTGGCTAAAGGCTGCCCAACACCGGGCCCAGTCCCTGAAGGAACAATTTCTGGTGTACAGCATGAGATTCTGCCCATATGCCCAGAGTGCGAGGCTTGTCTTGGCTGCCAAAGAAATCAAGCATGAAGTAATAAATATCAATCTGAAGAACCAGCCAGATTGGTTCTTTGAGAAGAGCCCATCTGGCCTGGTACCATCTCTGGAGACCAGCAATGGCCAGGTGATCTATGAATCTCCAATTGTGTGTGATTATCTGGATGAGGTTTATCCTGGGAAGAAGCTGACCCCTGCAGACCCATTCCAGAAAGCTCAACAAAAGATGACGGTGGAACATTTTTCCAAGGTCACAGCTGTGCTGTATAAGATATTGTGTGCCAAGGCAAATAATGAAGACCTATCAAGTGCGAAAGAAGAACTCCAGGAGAAGTTGCTTAAACTCGATGAGATCCTGGCTAAACAAAACAGCCATTTCTTTGGTGGAAGTGAAGTTTCTATGGTTGACTACATGATTTGGCCCTGGTTTGAACTGCTCATCATTTTTGATGTGAAGGATTGTTTTGTTAAAACCCCACTCATTGATAAATGGTGTCCACAGATGCTGCAGGATCCGGCGGTCAGGGCACCTATGATGAAACCAAACCCCTTTTTAACTTTTTTAACTTGTAATCCCGGGAAAACCTGGAGGCTTGGAATTGGGGGGCCGTGGGGGGCTTCTTGTTGGAAATTTTGGCATTAAAAAAGAAACCTATAAAAAAAAAAAAAAAAAAAAAAAA
Full Trace Sequence: GACCCCAAATAATAGATTTTATTTCTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTGGATCGGAGAAGTGTTTGGCTAAAGGCTGCCCAACACCGGGCCCAGTCCCTGAAGGAACAATTTCTGGTGTACAGCATGAGATTCTGCCCATATGCCCAGAGTGCGAGGCTTGTCTTGGCTGCCAAAGAAATCAAGCATGAAGTAATAAATATCAATCTGAAGAACCAGCCAGATTGGTTCTTTGAGAAGAGCCCATCTGGCCTGGTACCATCTCTGGAGACCAGCAATGGCCAGGTGATCTATGAATCTCCAATTGTGTGTGATTATCTGGATGAGGTTTATCCTGGGAAGAAGCTGACCCCTGCAGACCCATTCCAGAAAGCTCAACAAAAGATGACGGTGGAACATTTTTCCAAGGTCACAGCTGTGCTGTATAAGATATTGTGTGCCAAGGCAAATAATGAAGACCTATCAAGTGCGAAAGAAGAACTCCAGGAGAAGTTGCTTAAACTCGATGAGATCCTGGCTAAACAAAACAGCCATTTCTTTGGTGGAAGTGAAGTTTCTATGGTTGACTACATGATTTGGCCCTGGTTTGAACTGCTCATCATTTTTGATGTGAAGGATTGTTTTGTTAAAACCCCACTCATTGATAAATGGTGTCCACAGATGCTGCAGGATCCGGCGGTCAGGGCACCTATGATGAAACCAAACCCCTTTTTAACTTTTTTAACTTGTAATCCCGGGAAAACCTGGAGGCTTGGAATTGGGGGGCCGTGGGGGGCTTCTTGTTGGAAATTTTGGCATTAAAAAAGAAACCTATAAAAAAAAAAAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTGGATCGGAGAAGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ839033
dbEST ID: 79656735
Trimmed Sequence: GAGACCATAATCACAAGCCTCCAGATCTCCCTGGATGTACAGCTTAAAAAAGCTTAACATGGCGTCTGGTTCAATATATGTTGCCTTGACCGCTGGATCCTGCAGCATCTGTTGACACCACTTATCAATGAGTGGGGTTTTATTCAAACAATCCTTCACATCAAAAATGATGAGCAGTTCAAACCAGGGCCAAATCATGTAGTCAACCATAGAAACTTCACTTCCACCAAAGAAATGGCTGTTTTGTTTAGCCAGGATCTCATCGAGTTTAAGCAACTTCTCCTGGAGTTCTTCTTTCGCACCTGATAGGTCTTCATTATTTGCCTTGGCACACAATATCTTATACAGCACAGCTGTGACCTTGGAAAAATGTTCCACCGTCATCTTTTGTTGAGCTTTCTGGAATGGGTCTGCAGGGGTCAGCTTCTTCCCAGGATAAACCTCATCCAGATAATCACACACAATTGGAGATTCATAGATCACCTGGCCATTGCTGGTCTCCAGAGATGGTACCAGGCCAGATGGGCTCTTCTCAAAGAACCAATCTGGCTGGTTCTTTCGATTGATATTTATTACTTCCATGCTTGATTTCCTTGGCAGCCCAGAAAAACCTCCCACTCTGGGCATATGGGGCGAATTCACAGGGCTGTACAGCCAAATTGTTTCCCTCGGGGGAATGGGGGCCCGGTGGTGGGGGAGCCTTTTAACCCAAAACCTTCTCCCCAAATCCAGCTTCTGGGTGGTCCAACTTTTTTTGTGGGACCA
Full Trace Sequence: GGGAAAAATGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAGACCATAATCACAAGCCTCCAGATCTCCCTGGATGTACAGCTTAAAAAAGCTTAACATGGCGTCTGGTTCAATATATGTTGCCTTGACCGCTGGATCCTGCAGCATCTGTTGACACCACTTATCAATGAGTGGGGTTTTATTCAAACAATCCTTCACATCAAAAATGATGAGCAGTTCAAACCAGGGCCAAATCATGTAGTCAACCATAGAAACTTCACTTCCACCAAAGAAATGGCTGTTTTGTTTAGCCAGGATCTCATCGAGTTTAAGCAACTTCTCCTGGAGTTCTTCTTTCGCACCTGATAGGTCTTCATTATTTGCCTTGGCACACAATATCTTATACAGCACAGCTGTGACCTTGGAAAAATGTTCCACCGTCATCTTTTGTTGAGCTTTCTGGAATGGGTCTGCAGGGGTCAGCTTCTTCCCAGGATAAACCTCATCCAGATAATCACACACAATTGGAGATTCATAGATCACCTGGCCATTGCTGGTCTCCAGAGATGGTACCAGGCCAGATGGGCTCTTCTCAAAGAACCAATCTGGCTGGTTCTTTCGATTGATATTTATTACTTCCATGCTTGATTTCCTTGGCAGCCCAGAAAAACCTCCCACTCTGGGCATATGGGGCGAATTCACAGGGCTGTACAGCCAAATTGTTTCCCTCGGGGGAATGGGGGCCCGGTGGTGGGGGAGCCTTTTAACCCAAAACCTTCTCCCCAAATCCAGCTTCTGGGTGGTCCAACTTTTTTTGTGGGACCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAGACCATAATCACAAGCCTCCA