ORFeome > gtf2h1 ORF1 – XORFeome v1.0

gtf2h1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gtf2h1
Gene ID: 6078343
Gene Page ID: 975299
ORF Xenbase ID: 17278203

ORF full-length analysis tests

Full-Length confidence: medium
Original XGC clone accession: BC046266
Original XGC clone length: 1599

Human orthology & disease relationships

NCBI Entrez ID: 2965
Ensembl gene IDs: ENSG00000110768
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 151623,214150,216400,601675,607136

Library Location

Plate ID: GDExl11015
Well Location: A04

Sequences - 5ʹ (forward) EST

Accession: JZ824240
dbEST ID: 79641942
Trimmed Sequence: ATGGCCACCTCCTCAGAAGAAGTTTTACTGATCGTGAAGAAGGTGCGGCAGAAGAAGCAGGATGGGGCCCTTTATCTCATGGCCGAGAGGATCGCCTGGGCCCCCGAGGGCAAGGACCGCTTCATCATTAGCCACACGTACGCCGATATCAAATGTCAGAAAATCAGCCCCGATGGGAAAGCGAAGGTGCAGCTCCAGCTTGTGCTCCACTCTGGGGAGAATAGCAACTTCCACTTCTCTAACGATGTCACTGCCATCAAAGAGCGAGATGCCGTCAAAGAGCTTCTGCAGCAGCTGCTCCCCAAATTCAAGAGGAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCAGTCTTATTCCAGCTGTATAAAGATCTAGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTTTGGGCCAATCGGTTAAGCCTGAGCTCAGTGGAGAGCGGTGTGTCGGCGAGTAAACAAGACGTGGGAATATCGGCGGCGTTTCTGGCAGATGTTCGGCCACAAACCGACGGCTGTAACGGCCTCAGATACAACCTGACGTCTGACATCATTGAGTCCATATTCCGCACGTATCCCGCAGTGAAGCTGATATACGCAGAGAACGTGCCGCACAACATGACTGAGAAGGATTTCTGGAAGCAGTTTTTCCAGTCTCATTATTTCCACCGGGACCGGCTGAACTCCGGAGCCCAAGATCTGGTTTGCTGAGTGCGCCCAGATTGGATGAGAAAGGGCTAAAAGTCATGGTGGTTTCCCAGGGGGTGGAAAAAAACCCCAAGTTTTGGACTTGAATGGCCCTTGGAGGAGAAAAGGGCCTTGGA
Full Trace Sequence: ATTGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCACCTCCTCAGAAGAAGTTTTACTGATCGTGAAGAAGGTGCGGCAGAAGAAGCAGGATGGGGCCCTTTATCTCATGGCCGAGAGGATCGCCTGGGCCCCCGAGGGCAAGGACCGCTTCATCATTAGCCACACGTACGCCGATATCAAATGTCAGAAAATCAGCCCCGATGGGAAAGCGAAGGTGCAGCTCCAGCTTGTGCTCCACTCTGGGGAGAATAGCAACTTCCACTTCTCTAACGATGTCACTGCCATCAAAGAGCGAGATGCCGTCAAAGAGCTTCTGCAGCAGCTGCTCCCCAAATTCAAGAGGAAAGCCAATAAGGAACTGGAGGAGAAGAACAGAATGCTGAAGGAAGATCCAGTCTTATTCCAGCTGTATAAAGATCTAGTTGTGAGTCAGGTGATCAGCGCCGAGGAGTTTTGGGCCAATCGGTTAAGCCTGAGCTCAGTGGAGAGCGGTGTGTCGGCGAGTAAACAAGACGTGGGAATATCGGCGGCGTTTCTGGCAGATGTTCGGCCACAAACCGACGGCTGTAACGGCCTCAGATACAACCTGACGTCTGACATCATTGAGTCCATATTCCGCACGTATCCCGCAGTGAAGCTGATATACGCAGAGAACGTGCCGCACAACATGACTGAGAAGGATTTCTGGAAGCAGTTTTTCCAGTCTCATTATTTCCACCGGGACCGGCTGAACTCCGGAGCCCAAGATCTGGTTTGCTGAGTGCGCCCAGATTGGATGAGAAAGGGCTAAAAGTCATGGTGGTTTCCCAGGGGGTGGAAAAAAACCCCAAGTTTTGGACTTGAATGGCCCTTGGAGGAGAAAAGGGCCTTGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCACCTCCTCAGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829564
dbEST ID: 79647266
Trimmed Sequence: ACCCCAGCTCCTGCCCCAGAACCCCCCAGCTGCCCTTACATTGGTCCCCAGGTACTGCTTCCGGAGCTTCTCCTGGAAAGGACGCAGCTTCGTCACCTGGAACCGCTCCAAGTTGCTCTTCATTTTAATCACCTTTTCCTCTAGGAAGAGGGTGTTGACCGGGAAGCAGGACCAGAAATGGCGCAGCAGCTCCCCAACTGCCACGTACAGGTGCTTCAGCTCTACCTGAATGTCGTTTGGCACCAACTGGTTTATGGCTTGCTGAGTGACACCCTGCATCAGCGACCCCCCCGGGGTCAGAGCAGCAGTCGTACTACTGGCAGCACCACTCGACAGAACCTGAGTAAGCCTTGGGGTATAGTTTTCCATTTGTAGTTTAATACTATGGAAAGAGCTGAGAATATCCTGGCTGGAGGCATATTGCTGGGACTGTATCGGCGTCGGACCATGATAATACCTGTCAGATTTCTTCAGATTCAGCACAATGGGTTTCATTCCATTAGTCTGGTCCAAATCCTCATATTCTATGGCCTCCTGTAACTTCACCTTTTTGACAGGAGGCAGAAAGAAATCGGAGTCTCTGGAATTGCCGTCTGTGCTGCTGGTCTCACTGCACTGGTCACTCTGCGCCTCCTCCTTCCTGAGGCCGGCGGCGAGCACCATGGCGCTGTGATGGTTAAATCGCTTGATGATGGCGGCCGTTGCCTGTTCTCTTTGATGGAATTTGCTGCCTGGAC
Full Trace Sequence: CAGCGCATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACCCCAGCTCCTGCCCCAGAACCCCCCAGCTGCCCTTACATTGGTCCCCAGGTACTGCTTCCGGAGCTTCTCCTGGAAAGGACGCAGCTTCGTCACCTGGAACCGCTCCAAGTTGCTCTTCATTTTAATCACCTTTTCCTCTAGGAAGAGGGTGTTGACCGGGAAGCAGGACCAGAAATGGCGCAGCAGCTCCCCAACTGCCACGTACAGGTGCTTCAGCTCTACCTGAATGTCGTTTGGCACCAACTGGTTTATGGCTTGCTGAGTGACACCCTGCATCAGCGACCCCCCCGGGGTCAGAGCAGCAGTCGTACTACTGGCAGCACCACTCGACAGAACCTGAGTAAGCCTTGGGGTATAGTTTTCCATTTGTAGTTTAATACTATGGAAAGAGCTGAGAATATCCTGGCTGGAGGCATATTGCTGGGACTGTATCGGCGTCGGACCATGATAATACCTGTCAGATTTCTTCAGATTCAGCACAATGGGTTTCATTCCATTAGTCTGGTCCAAATCCTCATATTCTATGGCCTCCTGTAACTTCACCTTTTTGACAGGAGGCAGAAAGAAATCGGAGTCTCTGGAATTGCCGTCTGTGCTGCTGGTCTCACTGCACTGGTCACTCTGCGCCTCCTCCTTCCTGAGGCCGGCGGCGAGCACCATGGCGCTGTGATGGTTAAATCGCTTGATGATGGCGGCCGTTGCCTGTTCTCTTTGATGGAATTTGCTGCCTGGAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACCCCAGCTCCTGCCCC