ORFeome > gtf3a ORF1 – XORFeome v1.0

gtf3a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gtf3a
Gene ID: 6252591
Gene Page ID: 979622
ORF Xenbase ID: 17278227

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129561
Original XGC clone length: 1035

Human orthology & disease relationships

NCBI Entrez ID: 2971
Ensembl gene IDs: ENSG00000122034
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 151623,601675,607136

Library Location

Plate ID: GDExl11091
Well Location: G06

Sequences - 5ʹ (forward) EST

Accession: JZ838717
dbEST ID: 79656419
Trimmed Sequence: ATGGGAGAGAAGGCGCTGCCGGTGGTGTATAAGCGGTACATCTGCTCTTTCGCCGACTGCGGCGCTGCTTATAACAAGAACTGGAAACTGCAGGCGCATCTGTGCAAACACACAGGAGAGAAACCATTTCCATGTAAGGAAGAAGGATGTGAGAAAGGCTTTACCTCGCTTCATCACTTAACCCGCCACTCACTCACTCATACTGGCGAGAAAAACTTCACATGTGACTCGGATGGATGTGACTTGAGATTTACTACAAAGGCAAACATGAAGAAGCACTTTAACAGATTCCATAACATCAAGATCTGCGTCTATGTGTGCCATTTTGAGAACTGTGGCAAAGCATTCAAGAAACACAATCAATTAAAGGTTCATCAGTTCAGTCACACACAGCAGCTGCCATACGAATGTCCTCATGAAGGCTGTGACAAGCGGTTTTCTTTGCCTTCCCGTTTAAAACGTCATGAAAAAGTCCATGCAGGCTATCCCTGCAAAAAGGATGATTCTTGCTCATTTGTGGGAAAGACTTGGACATTATACTTGAAACACATGGCAGAATGCCATCAGGACCTAACAATATGTGATGTTTGTAATAGAAAATTCAGGCACGGAGATTACTTGAGGGATCATCAAAAAACTCACAAGAAAAAACAAACTGGGTATCTCTGGCCTCCAAAATGCTGTGACCGCTCCT
Full Trace Sequence: CTCGGGGGCCACATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGAGAGAAGGCGCTGCCGGTGGTGTATAAGCGGTACATCTGCTCTTTCGCCGACTGCGGCGCTGCTTATAACAAGAACTGGAAACTGCAGGCGCATCTGTGCAAACACACAGGAGAGAAACCATTTCCATGTAAGGAAGAAGGATGTGAGAAAGGCTTTACCTCGCTTCATCACTTAACCCGCCACTCACTCACTCATACTGGCGAGAAAAACTTCACATGTGACTCGGATGGATGTGACTTGAGATTTACTACAAAGGCAAACATGAAGAAGCACTTTAACAGATTCCATAACATCAAGATCTGCGTCTATGTGTGCCATTTTGAGAACTGTGGCAAAGCATTCAAGAAACACAATCAATTAAAGGTTCATCAGTTCAGTCACACACAGCAGCTGCCATACGAATGTCCTCATGAAGGCTGTGACAAGCGGTTTTCTTTGCCTTCCCGTTTAAAACGTCATGAAAAAGTCCATGCAGGCTATCCCTGCAAAAAGGATGATTCTTGCTCATTTGTGGGAAAGACTTGGACATTATACTTGAAACACATGGCAGAATGCCATCAGGACCTAACAATATGTGATGTTTGTAATAGAAAATTCAGGCACGGAGATTACTTGAGGGATCATCAAAAAACTCACAAGAAAAAACAAACTGGGTATCTCTGGCCTCCAAAATGCTGTGACCGCTCCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAGAGAAGGCGCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ838716
dbEST ID: 79656418
Trimmed Sequence: TTGTAAAGTTAATTTATCAAGAACCAATGAGTCATTTGTTTCAGTGCCAGAGGGCTTATTTTTCACAAGTGAATCAGTCTTTTCTGTTCCCGAAATGGATGCATTTTTTTCTTTGCTCTTGGGGGGTATGTATCCAGTGAGGCAAGAGGCCAGGCTTCTCTTTGGGCGAGGGCATTTCTCCTTTAGCTTCCTCTTCTCTGGATCATGTACAACTGAATGTCTTTCTAGGCTTTTTTTCATTGCAAAGCATTTCCCGCAGCCAGCATGCTCACAAACAAAAGGCCTCTGTTCCTCATGAAATGATTGTATATGGCTTCTAAGATTGAATGCAGTGGTATAGGAGCGGTCACAGCCATCTCGAGGGCAGAGATACACAGTTCGCTCTTTTTCGTGAGTTTTCTGATGATCCCTCAAGTAATCTTTGTGCCTGAATTTTCTATTACACACATCACATACTGCTAGGTCCTGATGGCATTCTGCCACGTGTTTCAAGTATAATGTCCAAGTCTTTCCCACAAATGAGCAAAAATCATCCTTTTTGCAGGGATAGCCTGCATGGACGTTTTCATGACGTTTTAAACGGGAAGGCAAAGAAAACCGCTTGTCACAGCCCTCATGAGGACATTCCTATGGCAGCCGCCGGGGTTGACTGAACGAAGAAACCTTTATTTAAATG
Full Trace Sequence: AACTGTCTATTGAACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTGTAAAGTTAATTTATCAAGAACCAATGAGTCATTTGTTTCAGTGCCAGAGGGCTTATTTTTCACAAGTGAATCAGTCTTTTCTGTTCCCGAAATGGATGCATTTTTTTCTTTGCTCTTGGGGGGTATGTATCCAGTGAGGCAAGAGGCCAGGCTTCTCTTTGGGCGAGGGCATTTCTCCTTTAGCTTCCTCTTCTCTGGATCATGTACAACTGAATGTCTTTCTAGGCTTTTTTTCATTGCAAAGCATTTCCCGCAGCCAGCATGCTCACAAACAAAAGGCCTCTGTTCCTCATGAAATGATTGTATATGGCTTCTAAGATTGAATGCAGTGGTATAGGAGCGGTCACAGCCATCTCGAGGGCAGAGATACACAGTTCGCTCTTTTTCGTGAGTTTTCTGATGATCCCTCAAGTAATCTTTGTGCCTGAATTTTCTATTACACACATCACATACTGCTAGGTCCTGATGGCATTCTGCCACGTGTTTCAAGTATAATGTCCAAGTCTTTCCCACAAATGAGCAAAAATCATCCTTTTTGCAGGGATAGCCTGCATGGACGTTTTCATGACGTTTTAAACGGGAAGGCAAAGAAAACCGCTTGTCACAGCCCTCATGAGGACATTCCTATGGCAGCCGCCGGGGTTGACTGAACGAAGAAACCTTTATTTAAATG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTGTAAAGTTAATTTATCAAGAAC