ORFeome > gtpbp10 ORF1 – XORFeome v1.0

gtpbp10 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: gtpbp10
Gene ID: 5853256
Gene Page ID: 5853230
ORF Xenbase ID: 17278251

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084856
Original XGC clone length: 1152

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: A04

Sequences - 5ʹ (forward) EST

Accession: JZ839997
dbEST ID: 79657699
Trimmed Sequence: ATGGTTTGGTGCTGCCGGGTGCTGCTCAGGAAGTATGGGAATTTTGTAGACAACTTGAGAATCTACGTTAAAGGTGGCACTGGTGGAATGGGCCTGCCCCGTTTAGGAGGTCAAGGAGGCAATGGAGGAGATGTATGTCTGCTGGCAAAAAAAGGAGTCACTTTGAAGAATATCAAAGACAAGTATCCCCATAAGCGTTTCATTGGTGGGGTTGGAGTCAACAGTAGTGTGCGTGCACTGAAAGGCCTGGCAGGAGAGGTGTGTCAGGTGGAGGTTCCCCCGGGGATTGTCATAACAAATGAGCATGGAGTCAAAATTGGGGAGCTTGATAAGGAGGGAGACGAAATCCGAGTAGCCAGGGGGGGTCATGGTGGTATTTTCAAGACAGATTTCCTTCCATCCAAAGGCCAGACAAGAGTAATCCATTTGGACTTGAAGCTTATTTCAGATGTTGGATTAGTAGGGTTTCCCAATGCAGGAAAATCGTCTTTGCTCGGCAAAATCTCCCATGCGAAACCCCAGGTTGCAGATTATGCCTTCACAACGGTGAAACCAAAACTGGGTTAAATCATGTATCCTGATTATAAACAGGTTTCAGTTGCTGACCTCCCAGGTTAATTGAAAGGGCTCATTACATTGAAGGGATGGGACAAAGTTTTCTAAGCATAATGAAAAAAAAAAGCCACTTCTTTTTTGTCTGGAAATTTAAGGAATACAACTTTTCCGCCATTTATCCCTTGCAAAACACCCTTTTGAAACAGTTCCACCCTAATGATTTTTGGAAGCTCG
Full Trace Sequence: CGGGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTTTGGTGCTGCCGGGTGCTGCTCAGGAAGTATGGGAATTTTGTAGACAACTTGAGAATCTACGTTAAAGGTGGCACTGGTGGAATGGGCCTGCCCCGTTTAGGAGGTCAAGGAGGCAATGGAGGAGATGTATGTCTGCTGGCAAAAAAAGGAGTCACTTTGAAGAATATCAAAGACAAGTATCCCCATAAGCGTTTCATTGGTGGGGTTGGAGTCAACAGTAGTGTGCGTGCACTGAAAGGCCTGGCAGGAGAGGTGTGTCAGGTGGAGGTTCCCCCGGGGATTGTCATAACAAATGAGCATGGAGTCAAAATTGGGGAGCTTGATAAGGAGGGAGACGAAATCCGAGTAGCCAGGGGGGGTCATGGTGGTATTTTCAAGACAGATTTCCTTCCATCCAAAGGCCAGACAAGAGTAATCCATTTGGACTTGAAGCTTATTTCAGATGTTGGATTAGTAGGGTTTCCCAATGCAGGAAAATCGTCTTTGCTCGGCAAAATCTCCCATGCGAAACCCCAGGTTGCAGATTATGCCTTCACAACGGTGAAACCAAAACTGGGTTAAATCATGTATCCTGATTATAAACAGGTTTCAGTTGCTGACCTCCCAGGTTAATTGAAAGGGCTCATTACATTGAAGGGATGGGACAAAGTTTTCTAAGCATAATGAAAAAAAAAAGCCACTTCTTTTTTGTCTGGAAATTTAAGGAATACAACTTTTCCGCCATTTATCCCTTGCAAAACACCCTTTTGAAACAGTTCCACCCTAATGATTTTTGGAAGCTCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTTTGGTGCTGCCGGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839996
dbEST ID: 79657698
Trimmed Sequence: GTGGTGTTTGTGCCGGGGGGAGGTTTGAAAGTTTCTTTTCACAGTCCTTGGTGTCTCTTTGTGGAGACTCTGAAGCCTCTCCTGAGCCAGTTCTTGAATTTGCACATCCGCCTGTTCATCTATTGTCTTCCGAATACAGCCAATGAGATCCTCCAGTCCCTGACCCGTCGCAGCAGAAACTGGAACGATGTGTTTAAACTCTATTTGTCTCTCTGGGACCAGCTCATCTGGCAGAGAATGCAGGTTTCCTGTGGGATTTTCAAGTTGCTTTAATAATTCCCCCAATTTCTCGTCTGCATTGGGAAGGTCCATCTTATTGACTGCGAGTACGGCGGGTTTGTCTAGAAGCTCCTCCTTGTATAACTGCAGCTCCGAGATCAGTAGCTGGACAGTTTCAAAGGCTGATCTGCACGGAGTAATGGCGGAGAGCTGGAATCCTGCAATGTCCACGACAAAAAGGAGCTGCTTTGTTCTTTCAATATGCTTCAGAAACTTGTGTCCCAGCCCTCTCTTGTAATGAGCCCCTTTCATTAAACCTGGAAAAGGCAGCCGGCTGAAACCTGCTTATAATCAGGAAACATGAGTTTTCCCAGTTTCTGGTTTCACGGGTTTTGAAGGCATTAGCTGCAACCTGGGGGTTTGGCATGGGGAAATTTGGCCAAACAAAAAACAAATTTTCCTGCCATGGGGAAACCCCTCCCAATCCCCACCATCTGGAAAATAACCTT
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGGTGTTTGTGCCGGGGGGAGGTTTGAAAGTTTCTTTTCACAGTCCTTGGTGTCTCTTTGTGGAGACTCTGAAGCCTCTCCTGAGCCAGTTCTTGAATTTGCACATCCGCCTGTTCATCTATTGTCTTCCGAATACAGCCAATGAGATCCTCCAGTCCCTGACCCGTCGCAGCAGAAACTGGAACGATGTGTTTAAACTCTATTTGTCTCTCTGGGACCAGCTCATCTGGCAGAGAATGCAGGTTTCCTGTGGGATTTTCAAGTTGCTTTAATAATTCCCCCAATTTCTCGTCTGCATTGGGAAGGTCCATCTTATTGACTGCGAGTACGGCGGGTTTGTCTAGAAGCTCCTCCTTGTATAACTGCAGCTCCGAGATCAGTAGCTGGACAGTTTCAAAGGCTGATCTGCACGGAGTAATGGCGGAGAGCTGGAATCCTGCAATGTCCACGACAAAAAGGAGCTGCTTTGTTCTTTCAATATGCTTCAGAAACTTGTGTCCCAGCCCTCTCTTGTAATGAGCCCCTTTCATTAAACCTGGAAAAGGCAGCCGGCTGAAACCTGCTTATAATCAGGAAACATGAGTTTTCCCAGTTTCTGGTTTCACGGGTTTTGAAGGCATTAGCTGCAACCTGGGGGTTTGGCATGGGGAAATTTGGCCAAACAAAAAACAAATTTTCCTGCCATGGGGAAACCCCTCCCAATCCCCACCATCTGGAAAATAACCTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGGTGTTTGTGCCGGG