ORFeome > gtsf1 ORF1 – XORFeome v1.0

gtsf1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gtsf1
Gene ID: 5878737
Gene Page ID: 5878703
ORF Xenbase ID: 17278275

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC123124
Original XGC clone length: 594

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: E03

Sequences - 5ʹ (forward) EST

Accession: JZ838023
dbEST ID: 79655725
Trimmed Sequence: ATGCCTGTAGAGAAGCCAGCTGAACCACACTTACCGGTACCTAAAAAGAGGACAAACTGGAATACTATGCTGCCAAACCCAACAAGGAATGTTGAGGTGGAAACCAGATTTTATGCTTCACAAGATCCAGAGAAGCTTCTGCAGTGCCCATATGATACAAATCACCAGATCAGAGCCTGTCGTTTCCCATATCATTTGATAAAGTGCAAGAAAAATCACACTGATATTGCAATGCAGCTTGCAACCTGTCCCTTCAATGCTCGTCACCTGGTTCCAAGGGCTGAACTCAGTCGCCACATCTTAAGCTGTGATGATAGAAGCTGCATTGAACAAGATATTGCTGGTGAAAAGAGTTATTACCAAAGAGATGCAAGTCCCTGCACCTGGAAAACCCCACCATGTGAGGAAGATTGGGACAAAGATCTGCAGAATAATAAAGCAACATTTATGTGGGGCATTCCTTCTTACCCTGTACCTAGCACTTCTGGGACAAACATCTTAATGGATGCTAAGAATAACCTTGGTTCAAGCCTACGTGCTCCTAAATCGCTGCCTTACATTTTGCCTTGGAAGATGCATAAAAAGAAAAGACTT
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTGTAGAGAAGCCAGCTGAACCACACTTACCGGTACCTAAAAAGAGGACAAACTGGAATACTATGCTGCCAAACCCAACAAGGAATGTTGAGGTGGAAACCAGATTTTATGCTTCACAAGATCCAGAGAAGCTTCTGCAGTGCCCATATGATACAAATCACCAGATCAGAGCCTGTCGTTTCCCATATCATTTGATAAAGTGCAAGAAAAATCACACTGATATTGCAATGCAGCTTGCAACCTGTCCCTTCAATGCTCGTCACCTGGTTCCAAGGGCTGAACTCAGTCGCCACATCTTAAGCTGTGATGATAGAAGCTGCATTGAACAAGATATTGCTGGTGAAAAGAGTTATTACCAAAGAGATGCAAGTCCCTGCACCTGGAAAACCCCACCATGTGAGGAAGATTGGGACAAAGATCTGCAGAATAATAAAGCAACATTTATGTGGGGCATTCCTTCTTACCCTGTACCTAGCACTTCTGGGACAAACATCTTAATGGATGCTAAGAATAACCTTGGTTCAAGCCTACGTGCTCCTAAATCGCTGCCTTACATTTTGCCTTGGAAGATGCATAAAAAGAAAAGACTTGCCCACTTTCTTGTACAAAGGTGGCATTATAAGAAAACATTGCTTTATAAGTTTATTGCAACGAACAGGTCACTTATCATTAAAATAAAATCATTAATTTCCATTCATCCTAAATCCTCTTAAATTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAATAAAGAAGAGCACTAGGGCCGGCGGCCGCAAGAGAGTGCTATAATTTTCCAATCCTTGTTGCGGGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTGTAGAGAAGCCA

Sequences - 3ʹ (reverse) EST

Accession: JZ838022
dbEST ID: 79655724
Trimmed Sequence: GTCTCTCTTTGTATGCATCTTCCAAGGCAAAATGTAAGGGAGCGATTTAGGAGCACGTAGGCTTGAACCAAGGTTATTCTTAGCATCCATTAAGATGTTTGTCCCAGAAGTGCTAGGTACAGGGTAAGAAGGAATGCCCCACATAAATGTTGCTTTATTATTCTGCAGATCTTTGTCCCAATCTTCCTCACATGGTGGGGTTTTCCAGGTGCAGGGACTTGCATCTCTTTGGTAATAACTCTTTTCACCAGCAATATCTTGTTCAATGCAGCTTCTATCATCACAGCTTAAGATGTGGCGACTGAGTTCAGCCCTTGGAACCAGGTGACGAACATTGAAGGGACGGGTTGCAAGCTGCATTGCAATATCAGTGTGATTTTTCTTGCACTTTATCGAATGATATGGGAAACGACAGGCTCTGATCTGGTGATTTGTATCGTATGGGCACGGCAGAGACTTCTCTGGAGCTTGGGAAGGGGAAAATACAATTTTGGGCCCCACATACCCTTTTTGGATTGGGGGGCGGAGAATTCAAGTGTTGCTTCTTGTTATTACAGGTAGGGGTGGGGGGGTGGGGGGTGGCGGCGCGCAAAAAGGGGGGGGTCTGTTTGGTAGTTCGGAGTGGGGAAAAAAGAAAAATACCGGTAGGGTTNNAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATATACTACCCGGGGCGGGGCCGGGCCCCCCCCCCCCCCCTCCCCCCCCCCTCGCGGGCGGG
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCTCTCTTTGTATGCATCTTCCAAGGCAAAATGTAAGGGAGCGATTTAGGAGCACGTAGGCTTGAACCAAGGTTATTCTTAGCATCCATTAAGATGTTTGTCCCAGAAGTGCTAGGTACAGGGTAAGAAGGAATGCCCCACATAAATGTTGCTTTATTATTCTGCAGATCTTTGTCCCAATCTTCCTCACATGGTGGGGTTTTCCAGGTGCAGGGACTTGCATCTCTTTGGTAATAACTCTTTTCACCAGCAATATCTTGTTCAATGCAGCTTCTATCATCACAGCTTAAGATGTGGCGACTGAGTTCAGCCCTTGGAACCAGGTGACGAACATTGAAGGGACGGGTTGCAAGCTGCATTGCAATATCAGTGTGATTTTTCTTGCACTTTATCGAATGATATGGGAAACGACAGGCTCTGATCTGGTGATTTGTATCGTATGGGCACGGCAGAGACTTCTCTGGAGCTTGGGAAGGGGAAAATACAATTTTGGGCCCCACATACCCTTTTTGGATTGGGGGGCGGAGAATTCAAGTGTTGCTTCTTGTTATTACAGGTAGGGGTGGGGGGGTGGGGGGTGGCGGCGCGCAAAAAGGGGGGGGTCTGTTTGGTAGTTCGGAGTGGGGAAAAAAGAAAAATACCGGTAGGGTTNNAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATATACTACCCGGGGCGGGGCCGGGCCCCCCCCCCCCCCCTCCCCCCCCCCTCGCGGGCGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCTCTCTTTGTATGCATCTTC