ORFeome > gucd1 ORF1 – XORFeome v1.0

gucd1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gucd1
Gene ID: 941305
Gene Page ID: 941299
ORF Xenbase ID: 17278287

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123258
Original XGC clone length: 756

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: F02

Sequences - 5ʹ (forward) EST

Accession: JZ838833
dbEST ID: 79656535
Trimmed Sequence: ATGAAGAATCCGGGACACAGCGACCCCGAGGGTAGTAAAGCTGCGAGCAGACCGCCTGGTGCCTCGGCTACAGACAGGAGTGACCATGTTCAGCTGAAAGTGCCGCTTATCCAGCAGTCCTATCACTGGGATTGTGGCCTGGCATGTGCCCGCATGGTGCTGCAGTATCAGAACCTTCTGCACGAGAATGAGTTTCAGAATGCTATGCACAAGCTCCAACTCACCAAGAGCATCTGGACAATTGATCTAGCCTATCTTATGCACCATTTTGGAGTCCAGCACCTGTTCTGCACTCAAACTTTAGGAGTTGATAAAGGTTATAAGAACCAGTCATTCTACAGAAAACACTTTGATGCAGAGGAAAACCGAGTAAATCAGCTGTTTGCACAAGCCAAATCCAGTGGAGTGAATGTGGAAAAACGCACTGTGACGATACAGGAATTACAGGAGCATCTTTCCCAGGGAAATGTGGCCATCGTACTAATAAATGCAGTGCTTTTACTGTGTGACTTGTGCCCGAGACGTGTCCAATATTGGCTGTTTTCTTCCAATTGGTCAAAGGTGTTTCTGCCGGAGCAGCGACTACCAAGGCCATTTTATTGTGCTTTGTGGTTACAACCAAAATTCTGGCGTGTTAGTTTTACACAATCCCAGAATATGCCCAGCCAATTATGTCAGACCAACATCCCCTTACTTTTGATAAATCCGCGGACCTTTAGTGGGACGAAAATAAAAATATTAGGTTTGTTTTTTTGTGGGAGGTTGGCCCAACGTTTCTTGGTCAAATGTTTTGGGTGTTGTTGAAAAGAGCACGTTTGCTTTTGTCAAA
Full Trace Sequence: CGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGAATCCGGGACACAGCGACCCCGAGGGTAGTAAAGCTGCGAGCAGACCGCCTGGTGCCTCGGCTACAGACAGGAGTGACCATGTTCAGCTGAAAGTGCCGCTTATCCAGCAGTCCTATCACTGGGATTGTGGCCTGGCATGTGCCCGCATGGTGCTGCAGTATCAGAACCTTCTGCACGAGAATGAGTTTCAGAATGCTATGCACAAGCTCCAACTCACCAAGAGCATCTGGACAATTGATCTAGCCTATCTTATGCACCATTTTGGAGTCCAGCACCTGTTCTGCACTCAAACTTTAGGAGTTGATAAAGGTTATAAGAACCAGTCATTCTACAGAAAACACTTTGATGCAGAGGAAAACCGAGTAAATCAGCTGTTTGCACAAGCCAAATCCAGTGGAGTGAATGTGGAAAAACGCACTGTGACGATACAGGAATTACAGGAGCATCTTTCCCAGGGAAATGTGGCCATCGTACTAATAAATGCAGTGCTTTTACTGTGTGACTTGTGCCCGAGACGTGTCCAATATTGGCTGTTTTCTTCCAATTGGTCAAAGGTGTTTCTGCCGGAGCAGCGACTACCAAGGCCATTTTATTGTGCTTTGTGGTTACAACCAAAATTCTGGCGTGTTAGTTTTACACAATCCCAGAATATGCCCAGCCAATTATGTCAGACCAACATCCCCTTACTTTTGATAAATCCGCGGACCTTTAGTGGGACGAAAATAAAAATATTAGGTTTGTTTTTTTGTGGGAGGTTGGCCCAACGTTTCTTGGTCAAATGTTTTGGGTGTTGTTGAAAAGAGCACGTTTGCTTTTGTCAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGAATCCGGGACAC

Sequences - 3ʹ (reverse) EST

Accession: JZ838832
dbEST ID: 79656534
Trimmed Sequence: GCTGTTCACATAAACAAACAGAATATCTTCATCTGTGCCATAACTGCTGCGTGATTCCTCAAAGTTAGTGATGCTGGTCTGACATAATCGGTCGGCATATCCTGGATTGTTGTAAAGTAAACTGCCAGAACTCTTGTTGTAACCACAAAGCACAATAAAATGGCCCTGGTAGTCGCTGCTCCTGCAGAAACACTTTTGACCAATTGGAAGAAAACAGCAGTATTTGACACGTCTGGGGCACAAGTCACACAGTAAAAGCACTGCATTTACTAGTACGATGGCCACATTTCCCTGGGAAAGATGCTCCTGTAATTCCTGTATCGTCACAGTGCGTTTTTCCACATTCACTCCACTGGATTTGGCTTGTGCAAACAGCTGATTTACTCGGTTTTCCTCTGCATCAAAGTGTTTTCTGTAGAATGACTGGTTCTTATAACCTTTATCAACTCCTAAAGTCTGAGTGCAGAACAGGTGCTGGACTCCAAAATGGTGCATAAGATAGGCTAGATCAATTGTCCAGATGCTCTTGGTGAGTTGGAGCTTGTGCATAGCATTCTGAAACTCATTCTCCTGCCAAAGGGTCTGATACTGCAACAACAAGGCGGGCACATTGCCGGCCACAATCCCCCGTGAATAGGAACTGCGGGATAAGCCGCACTTTTCACCTGAACATGGGTCACTTCCTGGTCTGTACCCAAAGGCACCAGGGGGGTCGGGCTCCGCAGCTTTTACTAACCCCTCCGTGGTTCGCTTGGTGTCCCGGGGAAATCTTCC
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTGTTCACATAAACAAACAGAATATCTTCATCTGTGCCATAACTGCTGCGTGATTCCTCAAAGTTAGTGATGCTGGTCTGACATAATCGGTCGGCATATCCTGGATTGTTGTAAAGTAAACTGCCAGAACTCTTGTTGTAACCACAAAGCACAATAAAATGGCCCTGGTAGTCGCTGCTCCTGCAGAAACACTTTTGACCAATTGGAAGAAAACAGCAGTATTTGACACGTCTGGGGCACAAGTCACACAGTAAAAGCACTGCATTTACTAGTACGATGGCCACATTTCCCTGGGAAAGATGCTCCTGTAATTCCTGTATCGTCACAGTGCGTTTTTCCACATTCACTCCACTGGATTTGGCTTGTGCAAACAGCTGATTTACTCGGTTTTCCTCTGCATCAAAGTGTTTTCTGTAGAATGACTGGTTCTTATAACCTTTATCAACTCCTAAAGTCTGAGTGCAGAACAGGTGCTGGACTCCAAAATGGTGCATAAGATAGGCTAGATCAATTGTCCAGATGCTCTTGGTGAGTTGGAGCTTGTGCATAGCATTCTGAAACTCATTCTCCTGCCAAAGGGTCTGATACTGCAACAACAAGGCGGGCACATTGCCGGCCACAATCCCCCGTGAATAGGAACTGCGGGATAAGCCGCACTTTTCACCTGAACATGGGTCACTTCCTGGTCTGTACCCAAAGGCACCAGGGGGGTCGGGCTCCGCAGCTTTTACTAACCCCTCCGTGGTTCGCTTGGTGTCCCGGGGAAATCTTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTGTTCACATAAACAAACAGAAT