ORFeome > gxylt1 ORF1 – XORFeome v1.0

gxylt1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gxylt1
Gene ID: 5868100
Gene Page ID: 5867992
ORF Xenbase ID: 17278305

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC099025
Original XGC clone length: 975

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: B01

Sequences - 5ʹ (forward) EST

Accession: JZ838408
dbEST ID: 79656110
Trimmed Sequence: ATGCATTTGGCCGTTGTTGCCTGCGGGGACAGACTGGAAGAGACTATTACTATGCTAAAATCCACCCCGGCTTTTTAGCAAGAAGTTACTTCAGTTTCACATTTTTGCAGAAGATCAATTACATTATGACTTCAAAGCTGCACTTAATAGTTGGGCATTTCCAGAGAAGTTTAAATATACTTTGTATCCAATAACATTTCCATTAGAAAACGCTGTGGAATGGAAGAAGTTGTTTAAACTCTGTGCATCACAAAGGCTATTCTTGCCGTTGATTCTTACGGAAGTTGACTCCTTGCTGTATGTTGACACGGACATTCTATTTTTACGCCCCTTGGATGACATCTGGTCTTTTTTGGGTGGCTTTAATGCCACGCAGATTGCTGCTATGGCCCCTGAGCATGAAGAGCCACGCATAGGATGGTATAATAGATTTGCTAGACATCCTTATTATGGAAAGACAGGCATCAATTCCGGAGTCATGTTAATGAATATGACCCGTATAAGAAAAAAGCATTTTAATAATGACATGACAACAGTTCGTTTACTCTGGGGAGATCTACTGTTGCCATTGCTAAAAAAATACAAGTTGAACATAACATGGGGGTGGACGAAAATTTACTGAAGTAGCAGGTTTTCCCGCACC
Full Trace Sequence: GGGCCCCTATAATGGAATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCATTTGGCCGTTGTTGCCTGCGGGGACAGACTGGAAGAGACTATTACTATGCTAAAATCCACCCCGGCTTTTTAGCAAGAAGTTACTTCAGTTTCACATTTTTGCAGAAGATCAATTACATTATGACTTCAAAGCTGCACTTAATAGTTGGGCATTTCCAGAGAAGTTTAAATATACTTTGTATCCAATAACATTTCCATTAGAAAACGCTGTGGAATGGAAGAAGTTGTTTAAACTCTGTGCATCACAAAGGCTATTCTTGCCGTTGATTCTTACGGAAGTTGACTCCTTGCTGTATGTTGACACGGACATTCTATTTTTACGCCCCTTGGATGACATCTGGTCTTTTTTGGGTGGCTTTAATGCCACGCAGATTGCTGCTATGGCCCCTGAGCATGAAGAGCCACGCATAGGATGGTATAATAGATTTGCTAGACATCCTTATTATGGAAAGACAGGCATCAATTCCGGAGTCATGTTAATGAATATGACCCGTATAAGAAAAAAGCATTTTAATAATGACATGACAACAGTTCGTTTACTCTGGGGAGATCTACTGTTGCCATTGCTAAAAAAATACAAGTTGAACATAACATGGGGGTGGACGAAAATTTACTGAAGTAGCAGGTTTTCCCGCACC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCATTTGGCCGTTGTTGCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838407
dbEST ID: 79656109
Trimmed Sequence: CCGTTTGTTGGATTGCCTTCTGTAAAGCTCTTCAATGGTTTTTGTCAGCTGCTTAGTGAATATCTCATGAATCCTGCCACAGTAGGTATGTGCTGTTTTCGGCATTTCCAGTTCTAAAGGATATAGTAACGACTGGCGAAGGTCATGCCCAAATGAGTAATTTCGGAATGCTTCATACACAGCTCTAAATGCTGGTTGTTTTCTGTCATGGTAAACACCTCTGTTGCCATGAAGAATAAATATGCCATCTTCTGCTTCATGGCAATTGCTTCCATAAATGCAGTGATCAAGACGGTAATTCCATTGACAAGGGAAGACAAACAAGCTTTCTGGATTGTGAGAAAACATGATATTCAATAAATCTTGGTCACCCCATGTTATGTTCAACTTGAATTTTTTTATCAATGGCAGCAATAGATCTCCCCAGTGTAAACGAACTGTTGTCATGTCATTCTTAAAATGCATTTTTCTTATACAGAGCAGATGCATTAACATGACTCCGGAAGTGGAGGCCTGTCTTTCCCTACTCAAGAAGTGTAGCGGATCTGATAAAACCATCCGATGGGTTCCTCTTGGGTCTTAGGGGGCTTAGGCGACAAACTACGTTCCGGGGGGGTGCATCCTAAAAGAAAAAAAAATAATCAGC
Full Trace Sequence: GGGGAAAATGTCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCGTTTGTTGGATTGCCTTCTGTAAAGCTCTTCAATGGTTTTTGTCAGCTGCTTAGTGAATATCTCATGAATCCTGCCACAGTAGGTATGTGCTGTTTTCGGCATTTCCAGTTCTAAAGGATATAGTAACGACTGGCGAAGGTCATGCCCAAATGAGTAATTTCGGAATGCTTCATACACAGCTCTAAATGCTGGTTGTTTTCTGTCATGGTAAACACCTCTGTTGCCATGAAGAATAAATATGCCATCTTCTGCTTCATGGCAATTGCTTCCATAAATGCAGTGATCAAGACGGTAATTCCATTGACAAGGGAAGACAAACAAGCTTTCTGGATTGTGAGAAAACATGATATTCAATAAATCTTGGTCACCCCATGTTATGTTCAACTTGAATTTTTTTATCAATGGCAGCAATAGATCTCCCCAGTGTAAACGAACTGTTGTCATGTCATTCTTAAAATGCATTTTTCTTATACAGAGCAGATGCATTAACATGACTCCGGAAGTGGAGGCCTGTCTTTCCCTACTCAAGAAGTGTAGCGGATCTGATAAAACCATCCGATGGGTTCCTCTTGGGTCTTAGGGGGCTTAGGCGACAAACTACGTTCCGGGGGGGTGCATCCTAAAAGAAAAAAAAATAATCAGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCGTTTGTTGGATTGCCT