ORFeome > h1fx ORF1 – XORFeome v1.0

h1fx ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: h1fx
Gene ID: 6254472
Gene Page ID: 5928643
ORF Xenbase ID: 17278365

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041758
Original XGC clone length: 654

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11010
Well Location: F01

Sequences - 5ʹ (forward) EST

Accession: JZ823703
dbEST ID: 79641405
Trimmed Sequence: ATGGCTCTAGAGCTGGAAGAGAATTTACACAGCACCGAGGAGGAGGACGAAGAAGAGGAGGAGGAGGAAGGCGATGAGATGAGAAGCCGCAGTACAAGAAACAAGGGGGGCGCCGCCTCCAGCTCCGGCAACAAAAAGAAGAAGAAGAAAAAGAACCAGCCGGGCCGCTACAGCCAACTCGTAGTGGACACGATCCGCAAACTGGGGGAGAGGAACGGCTCGTCCCTGGCCAAGATCTACAGCGAAGCCAAGAAAGTGTCCTGGTTCGACCAACAGAACGGCCGCACGTACCTGAAGTACAGCATCAAGGCGCTGGTGCAGAACGATACCCTCCTGCAGGTCAAGGGCGTCGGGGCCAACGGCTCGTTCCGCCTCAACAAGAAGAAACTCGAGGGGCTGCCCTATGACAAGAAGCCGCCGCCCGCCAAGCCCTCCAGCAGCAGCAGCAGCAACAAGAAGCAGCAGCAGGGGCCCAGCAGCAGCCCGAGTAAGAGCCACAAGAAGGCCAAGCCAAAGGCCAAGGCTGAGAAGGAGAAGCCAAAGACGAGCAGCGCCAAAGCCAAGAGTCCCAAGAAATCCGCTGCCAAGGGGAAGAAAATGAAGAAAGGGGCCAAGCCCAGCGTCCGCAAAGCGCCTAAATCCAAGAAAGCGTT
Full Trace Sequence: GGGCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTCTAGAGCTGGAAGAGAATTTACACAGCACCGAGGAGGAGGACGAAGAAGAGGAGGAGGAGGAAGGCGATGAGATGAGAAGCCGCAGTACAAGAAACAAGGGGGGCGCCGCCTCCAGCTCCGGCAACAAAAAGAAGAAGAAGAAAAAGAACCAGCCGGGCCGCTACAGCCAACTCGTAGTGGACACGATCCGCAAACTGGGGGAGAGGAACGGCTCGTCCCTGGCCAAGATCTACAGCGAAGCCAAGAAAGTGTCCTGGTTCGACCAACAGAACGGCCGCACGTACCTGAAGTACAGCATCAAGGCGCTGGTGCAGAACGATACCCTCCTGCAGGTCAAGGGCGTCGGGGCCAACGGCTCGTTCCGCCTCAACAAGAAGAAACTCGAGGGGCTGCCCTATGACAAGAAGCCGCCGCCCGCCAAGCCCTCCAGCAGCAGCAGCAGCAACAAGAAGCAGCAGCAGGGGCCCAGCAGCAGCCCGAGTAAGAGCCACAAGAAGGCCAAGCCAAAGGCCAAGGCTGAGAAGGAGAAGCCAAAGACGAGCAGCGCCAAAGCCAAGAGTCCCAAGAAATCCGCTGCCAAGGGGAAGAAAATGAAGAAAGGGGCCAAGCCCAGCGTCCGCAAAGCGCCTAAATCCAAGAAAGCGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCATTTTGTTGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCTAGAGCTGGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829013
dbEST ID: 79646715
Trimmed Sequence: CGCTTTCTTGGATTTAGGCGCTTTGCGGACGCTGGGCTTGGCCCCTTTCTTCATTTTCTTCCCCTTGGCAGCGGATTTCTTGGGACTCTTGGCTTTGGCGCTGCTCGTCTTTGGCTTCTCCTTCTCAGCCTTGGCCTTTGGCTTGGCCTTCTTGTGGCTCTTACTCGGGCTGCTGCTGGGCCCCTGCTGCTGCTTCTTGTTGCTGCTGCTGCTGCTGGAGGGCTTGGCGGGCGGCGGCTTCTTGTCATAGGGCAGCCCCTCGAGTTTCTTCTTGTTGAGGCGGAACGAGCCGTTGGCCCCGACGCCCTTGACCTGCAGGAGGGTATCGTTCTGCACCAGCGCCTTGATGCTGTACTTCAGGTACGTGCGGCCGTTCTGTTGGTCGAACCACGACACTTTCTTGGCTTCGCTGTAGATCTTGGCCAGGGACGAGCCGTTCCTCTCCCCCAGTTTGCGGATCGTGTCCACTACGAGTTGGCTGTAGCGGCCCGGCTGGTTCTTTTTCTTCTTCTTCTTTTTGTTGCCGGAGCTGGAGGCGGCGCCCCCCTTGTTTCTTGTACTGCGGCCTCTCATCTCATCGCCTTCATCCTCCTCGTCTTCTTCGTCCTGCTCCCCGGTGCTGTGGAAATTCTCTTACACCTCTTACACCGTGGTTGCCAACTTAATTTGTACAAAGTTGGCCTTA
Full Trace Sequence: GGAACAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACGCTTTCTTGGATTTAGGCGCTTTGCGGACGCTGGGCTTGGCCCCTTTCTTCATTTTCTTCCCCTTGGCAGCGGATTTCTTGGGACTCTTGGCTTTGGCGCTGCTCGTCTTTGGCTTCTCCTTCTCAGCCTTGGCCTTTGGCTTGGCCTTCTTGTGGCTCTTACTCGGGCTGCTGCTGGGCCCCTGCTGCTGCTTCTTGTTGCTGCTGCTGCTGCTGGAGGGCTTGGCGGGCGGCGGCTTCTTGTCATAGGGCAGCCCCTCGAGTTTCTTCTTGTTGAGGCGGAACGAGCCGTTGGCCCCGACGCCCTTGACCTGCAGGAGGGTATCGTTCTGCACCAGCGCCTTGATGCTGTACTTCAGGTACGTGCGGCCGTTCTGTTGGTCGAACCACGACACTTTCTTGGCTTCGCTGTAGATCTTGGCCAGGGACGAGCCGTTCCTCTCCCCCAGTTTGCGGATCGTGTCCACTACGAGTTGGCTGTAGCGGCCCGGCTGGTTCTTTTTCTTCTTCTTCTTTTTGTTGCCGGAGCTGGAGGCGGCGCCCCCCTTGTTTCTTGTACTGCGGCCTCTCATCTCATCGCCTTCATCCTCCTCGTCTTCTTCGTCCTGCTCCCCGGTGCTGTGGAAATTCTCTTACACCTCTTACACCGTGGTTGCCAACTTAATTTGTACAAAGTTGGCCTTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACGCTTTCTTGGATTTAGGCGCTT