ORFeome > h2afz ORF1 – XORFeome v1.0

h2afz ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: h2afz
Gene ID: 6256368
Gene Page ID: 485053
ORF Xenbase ID: 17278419

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044011
Original XGC clone length: 387

Human orthology & disease relationships

NCBI Entrez ID: 3015
Ensembl gene IDs: ENSG00000164032
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 182290,600652,603278,607841

Library Location

Plate ID: GDExl11016
Well Location: F08

Sequences - 5ʹ (forward) EST

Accession: JZ824279
dbEST ID: 79641981
Trimmed Sequence: ATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTT
Full Trace Sequence: ACCCAATAATGAAGCGCATATGATTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGGTGGCAAGGCTGGCAAAGATACCGGAAAAGCCAAGGCAACCTCTATCACCCGATCCTCCAGAGCTGGTCTGCAGTTTCCAGTTGGTCGTATACACAGACTTCTGAAAAACAGAACTACCAGTCATGGGCGTGTGGGTGGTACAGCAGCAGTGTATACAGCTGCTATCTTGGAATATCTGACTGCTGAGGTTCTTGAATTGGCTGGAAATGCTTCCAAAGACCTTAAGGTGAAGCGTATTAGTCCACGTCACTTGCAACTTGCCATCAGAGGTGATGAAGAATTGGATGCTCTTATAAAAGCAACTATTGCTGGTGGTGGAGTCATTCCACATATACACAAGTCCCTCATTGGAAAGAAAGGACAGCAGAAAACAGTCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCGGGTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGAAACGTGTCTCAAAATCTCTGATGTTACAGNTGGTTGTNNGTGTGTTCTCGCTCTTGGGGGCCGTTCCCGCTTTTCCTTTGTTTTGTGGTTTGCTTTGCTCTGGCCTTGCGTGAAAAAGGGCGGCGGAACTGCCCACTAATTCAAACTTTGTCTTATTGCTTTTAATGAAACCGTTTTCCCTCGACTTCCATATTAAAAACTCCGGATCTACCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGGTGGCAAGGCTGG

Sequences - 3ʹ (reverse) EST

Accession: JZ829610
dbEST ID: 79647312
Trimmed Sequence: GACTGTTTTCTGCTGTCCTTTCTTTCCAATGAGGGACTTGTGTATATGTGGAATGACTCCACCACCAGCAATAGTTGCTTTTATAAGAGCATCCAATTCTTCATCACCTCTGATGGCAAGTTGCAAGTGACGTGGACTAATACGCTTCACCTTAAGGTCTTTGGAAGCATTTCCAGCCAATTCAAGAACCTCAGCAGTCAGATATTCCAAGATAGCAGCTGTATACACTGCTGCTGTACCACCCACACGCCCATGACTGGTAGTTCTGTTTTTCAGAAGTCTGTGTATACGACCAACTGGAAACTGCAGACCAGCTCTGGAGGATCGGGTGATAGAGGTTGCCTTGGCTTTTCCGGTATCTTTGCCAGCCTTGCCACCAGCCATGG
Full Trace Sequence: GCTGACAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGACTGTTTTCTGCTGTCCTTTCTTTCCAATGAGGGACTTGTGTATATGTGGAATGACTCCACCACCAGCAATAGTTGCTTTTATAAGAGCATCCAATTCTTCATCACCTCTGATGGCAAGTTGCAAGTGACGTGGACTAATACGCTTCACCTTAAGGTCTTTGGAAGCATTTCCAGCCAATTCAAGAACCTCAGCAGTCAGATATTCCAAGATAGCAGCTGTATACACTGCTGCTGTACCACCCACACGCCCATGACTGGTAGTTCTGTTTTTCAGAAGTCTGTGTATACGACCAACTGGAAACTGCAGACCAGCTCTGGAGGATCGGGTGATAGAGGTTGCCTTGGCTTTTCCGGTATCTTTGCCAGCCTTGCCACCAGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGAAAAACACTGGCCGTCGTTTTACAACTCGGTGACTGGGCAGTTNCCCTTNGGGGCGTTGTTGTTGCTCCTTGTCCGGCTTCTTGGTGCCCCGGTGGGATTTCCCCCTCGCGTCTGGTCGGGGGTCGCCCTGGGTGTCCGGGCCGGGGGGGTTTACGCGGGGAGAGATTCTAGAATCGGTAAGAGGGGATGGGTTCCTTCATCTTTGGACCGAGGGGGGGCAGTTTTTTTCGACGAGTGGCGTTTTTACAAAGAACAGGTTTCCAAAAATTTTGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACTGTTTTCTGCTGTCCT