ORFeome > hadh ORF1 – XORFeome v1.0

hadh ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hadh
Gene ID: 1007284
Gene Page ID: 1007277
ORF Xenbase ID: 17278479

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056108
Original XGC clone length: 942

Human orthology & disease relationships

NCBI Entrez ID: 3033
Ensembl gene IDs: ENSG00000138796
Directly associated (OMIM) disease MIM numbers: 231530,609975
Indirectly associated (Lage, et al.) disease MIM numbers: 203750,231530,245050,250950,300438,312170,606054,609015,609016,609975

Library Location

Plate ID: GDExl11020
Well Location: F11

Sequences - 5ʹ (forward) EST

Accession: JZ824725
dbEST ID: 79642427
Trimmed Sequence: ATGGCGTCCTCCAGCACAAGACAGTTACTTGCACGCTGTATGTCTACAGCTCCGGCCGCGGCCAAGAAGCTCGCCATCAAGCATGTGACAGTGATCGGGGGCGGCCTGATGGGAGCGGGGATAGCGCAGGTGGCTGCAGCTACAGGTCACACAGTTGTGCTGGTGGACCAGACAGATGACATCCTAAAAAAATCTAGAAAAAGCATTGAAGACAGCTTGAAAAGAGTAACAAAGAAGATGTTTTCAGATAAACCTGAGGCTGCTTCTCAGTTTATTGAAAAAATCCTTGGAAACTTTGCAACCAGCACAGACCCAGCAGCTGTTGTGCACAGCACTGACCTTGTGGTTGAAGCCATTGTGGAGAATTTGGATGTGAAGCATGAGCTCTTCAAAAGACTAGATAAATTTGCCCCTGAGCATACTATATTTGCTAGCAACACCTCATCATTGCCAATTACAGATATAGCAAATTCCACAACCAGGCAGGACCGGTTTGGTGGCTTGCATTTCTTTAACCCTGTGCCAATGATGAAGCTTGTAGAGGTGATAAAGACACCAATGACAAGCCAAACAACTTTTGAGTCCCTCATGGATTTTAGTAAAGCTCTTGGGAAAACACCAGTGTCATGCAAGGACACCCCTGGCTTTATTGTAACCNGCCTTCTTGTGCCATACCTAATGGAATCTGTCCGACTTTACGAGCGAGGGCATGCATCAAAGAAAAACATGGATGTTCCAATGAAACTGGGAGCTGGCTATCCTAATGGGTCCTTTTGAACTTGCTGGATTACCGTTGGGACGGGAACCCCAAGTAAAATTCCATTATTTGAAG
Full Trace Sequence: AATGAATTTTATTTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGTCCTCCAGCACAAGACAGTTACTTGCACGCTGTATGTCTACAGCTCCGGCCGCGGCCAAGAAGCTCGCCATCAAGCATGTGACAGTGATCGGGGGCGGCCTGATGGGAGCGGGGATAGCGCAGGTGGCTGCAGCTACAGGTCACACAGTTGTGCTGGTGGACCAGACAGATGACATCCTAAAAAAATCTAGAAAAAGCATTGAAGACAGCTTGAAAAGAGTAACAAAGAAGATGTTTTCAGATAAACCTGAGGCTGCTTCTCAGTTTATTGAAAAAATCCTTGGAAACTTTGCAACCAGCACAGACCCAGCAGCTGTTGTGCACAGCACTGACCTTGTGGTTGAAGCCATTGTGGAGAATTTGGATGTGAAGCATGAGCTCTTCAAAAGACTAGATAAATTTGCCCCTGAGCATACTATATTTGCTAGCAACACCTCATCATTGCCAATTACAGATATAGCAAATTCCACAACCAGGCAGGACCGGTTTGGTGGCTTGCATTTCTTTAACCCTGTGCCAATGATGAAGCTTGTAGAGGTGATAAAGACACCAATGACAAGCCAAACAACTTTTGAGTCCCTCATGGATTTTAGTAAAGCTCTTGGGAAAACACCAGTGTCATGCAAGGACACCCCTGGCTTTATTGTAACCNGCCTTCTTGTGCCATACCTAATGGAATCTGTCCGACTTTACGAGCGAGGGCATGCATCAAAGAAAAACATGGATGTTCCAATGAAACTGGGAGCTGGCTATCCTAATGGGTCCTTTTGAACTTGCTGGATTACCGTTGGGACGGGAACCCCAAGTAAAATTCCATTATTTGAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGTCCTCCAGCACAA

Sequences - 3ʹ (reverse) EST

Accession: JZ830077
dbEST ID: 79647779
Trimmed Sequence: TTTGTACTTATAAAACCCTTCTCCTGTCTTCTTGCCAAGTTTCTTCTCAGCAACCAGCTTATTTAATAATTCACTCGGTGCGAACAAAGGATTGTCTGGCTCCATCTGATGCCATCCGTCAATAATGAATTTACTGGTGTCCAGTCCAACGTAATCCAGCAGTTCAAAAGGACCCATAGGATAGCCAGCTCCCAGCTTCATTGCAACATCAATGTCTTCTTTTGATGCATGCCCTCGCTCGTAAAGTCGGACAGATTCCATTAGGTATGGCACAAGAAGGCGGTTAACAATAAAGCCAGGGGTGTCCTTGCATGACACTGGTGTTTTCCCAAGAGCTTTACTAAAATCCATGAGGGACTCAAAAGTTGTTTGGCTTGTCATTGGTGTCTTTATCACCTCTACAAGCTTCATCATTGGCACAGGGTTAAAGAAATGCAAGCCACCAAACCGGTCCTGCCTGGTTGTGGAATTTGCTATATCTGTAATTGGCAATGATGAGGTGTTGCTAGCAAATATAGTATGCTCAGGGGCAAATTTATCTAGTCTTTTGAAGAGCTCATGCTTCACATCCNAATTCTCCACAATGGCTTCAACCACAAAGTCAGTGCTGTGCACAACAACTGCTGGGTCTGTGCTGGTTGCAAGTTTCCCAGGAATTTTTTCAATAAACTGAGGAGCCAGCCTCAGGTTTATTCTGAAAACATCTTTCTTTTGTTACTTCTTTTTCAAGCTTGGTCTTCAATGGCCTTTTTTCCATAAATTTTTTTT
Full Trace Sequence: CGGGTAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTGTACTTATAAAACCCTTCTCCTGTCTTCTTGCCAAGTTTCTTCTCAGCAACCAGCTTATTTAATAATTCACTCGGTGCGAACAAAGGATTGTCTGGCTCCATCTGATGCCATCCGTCAATAATGAATTTACTGGTGTCCAGTCCAACGTAATCCAGCAGTTCAAAAGGACCCATAGGATAGCCAGCTCCCAGCTTCATTGCAACATCAATGTCTTCTTTTGATGCATGCCCTCGCTCGTAAAGTCGGACAGATTCCATTAGGTATGGCACAAGAAGGCGGTTAACAATAAAGCCAGGGGTGTCCTTGCATGACACTGGTGTTTTCCCAAGAGCTTTACTAAAATCCATGAGGGACTCAAAAGTTGTTTGGCTTGTCATTGGTGTCTTTATCACCTCTACAAGCTTCATCATTGGCACAGGGTTAAAGAAATGCAAGCCACCAAACCGGTCCTGCCTGGTTGTGGAATTTGCTATATCTGTAATTGGCAATGATGAGGTGTTGCTAGCAAATATAGTATGCTCAGGGGCAAATTTATCTAGTCTTTTGAAGAGCTCATGCTTCACATCCNAATTCTCCACAATGGCTTCAACCACAAAGTCAGTGCTGTGCACAACAACTGCTGGGTCTGTGCTGGTTGCAAGTTTCCCAGGAATTTTTTCAATAAACTGAGGAGCCAGCCTCAGGTTTATTCTGAAAACATCTTTCTTTTGTTACTTCTTTTTCAAGCTTGGTCTTCAATGGCCTTTTTTCCATAAATTTTTTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTGTACTTATAAAACCCTTCTCC