ORFeome > haghl ORF1 – XORFeome v1.0

haghl ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: haghl
Gene ID: 987563
Gene Page ID: 987559
ORF Xenbase ID: 17278503

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123176
Original XGC clone length: 903

Human orthology & disease relationships

NCBI Entrez ID: 84264
Ensembl gene IDs: ENSG00000103253
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 260000

Library Location

Plate ID: GDExl11087
Well Location: D07

Sequences - 5ʹ (forward) EST

Accession: JZ838053
dbEST ID: 79655755
Trimmed Sequence: ATGAAGGTTAAAGTCATATCAGTGCTGGATGATAACTACATGTACCTGGTGATAGAGGAGCACACGAGAGATGCCATTGCAGTGGATGCTTCTGTGGCTAAAAAGTTAATAGAGATTGTCAGAAAAGAAGGAGCCCACCTGAAAGCCGTTCTGACTACCCATCACCACCTGGATCATTCCCGAGGAAACCCGGATCTGCTCCAGCGATTCCCCGAGCTGCAGGTGTACGGGGCCGACGACAGGATTGGAGGGCTGACACACAGGCTCGTCCATAACCAAGAACTGAAGTTTGGGGGTATTAACGTGAGATGCCTCTTCACCCCTTGTCATACGTCGGGGCACATGTGCTTCTTCATATGGGAAGACGGCTGCCCTGATGCCCCAGCGCTGTTCTCAGGTGACTTATTGGAGCAGCTGGTGGGACAGACACACAGGGACACACTGTTCGTTGGAGGCTGTGGGATGTTTTATGAAGGGACGGCAGAGCAGATGTACAAGAACCTGTCGGAGACACTTGGATCCCTCCCCAAAGACACCAAAGTATTTTGCGGCCATGAATATACCGTGAGGAACCTGAAGTTTGCGCTTAAGGTGGAGCCAAGTAATGAGAAGGTGAAGGAGAAGCTGGCGTGGGCCAAGGCTCGAGATGAAGATGATATTCCTACTGTCCCCTCCAGCCTGGAGGAGGAGTTTCTTTACAACCCCTTCCTGAACAATGA
Full Trace Sequence: TTCGAGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGGTTAAAGTCATATCAGTGCTGGATGATAACTACATGTACCTGGTGATAGAGGAGCACACGAGAGATGCCATTGCAGTGGATGCTTCTGTGGCTAAAAAGTTAATAGAGATTGTCAGAAAAGAAGGAGCCCACCTGAAAGCCGTTCTGACTACCCATCACCACCTGGATCATTCCCGAGGAAACCCGGATCTGCTCCAGCGATTCCCCGAGCTGCAGGTGTACGGGGCCGACGACAGGATTGGAGGGCTGACACACAGGCTCGTCCATAACCAAGAACTGAAGTTTGGGGGTATTAACGTGAGATGCCTCTTCACCCCTTGTCATACGTCGGGGCACATGTGCTTCTTCATATGGGAAGACGGCTGCCCTGATGCCCCAGCGCTGTTCTCAGGTGACTTATTGGAGCAGCTGGTGGGACAGACACACAGGGACACACTGTTCGTTGGAGGCTGTGGGATGTTTTATGAAGGGACGGCAGAGCAGATGTACAAGAACCTGTCGGAGACACTTGGATCCCTCCCCAAAGACACCAAAGTATTTTGCGGCCATGAATATACCGTGAGGAACCTGAAGTTTGCGCTTAAGGTGGAGCCAAGTAATGAGAAGGTGAAGGAGAAGCTGGCGTGGGCCAAGGCTCGAGATGAAGATGATATTCCTACTGTCCCCTCCAGCCTGGAGGAGGAGTTTCTTTACAACCCCTTCCTGAACAATGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGGTTAAAGTCATATCAGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ838052
dbEST ID: 79655754
Trimmed Sequence: AGTTCTTGGTGGGGAGTTTTCATCTGAGGAGGACTGACTGAGAAAGCCCATCTGGAAAGCAAGGACGGCGGGAATTGGAAATCGATCCTTCGGCTTCTTAAACTCATCCTTTTCCTTCCTCAAAACTCGCATCACTTCCACCGGGTTGGTTTTTCCTGTGAATTTCATTACAGCCTCCTCCCTCACTCTCATGAAGGGGTTGTAAAGAAACTCCTCCTCCAGGCTGGAAGGGACAGTAGGAATATCATCTTCATCTCGAGCCTTGGCCCACGCCAGCTTCTCCTTCACCTTCTCATTACTTGGCTCCACCTTAAGCGCAAACTTCAGGTTCCTCACGGTATATTCATGGCCGCAAAATACTTTGGTGTCTTTGGGGAGGGATCCAAGTGTCTCCGACAGGTTCTTGTACATCTGCTCTGCCGTCCCTTCATAAAACATCCCACAGCCTCCGACGAACAGTGTGTCCCTGTGTGTCTGTCCCACCAGCTGCTCCGATAAATCACCTGAAAACAGCGCTGGGGCATCAGGGCAGCCGTCTTCCCATATAAAGAAACACATGTGCCCCGACGTATGAACAGGGGGTGAGAGGCATCTCACGTTTATACCCCCAAACTTCCATTTCTTGGTAATGGAAAAGCTGGGGGGTCGCCCCTCCATCCTGCCCTCCGCCCCCCTACCCTTCCACCTTGGGGGATTCCCTGGAAACAAAACCCGGGTTTCCCTCCGGAAAAGAACCCAGGGGGGTAGAGGGGGGAGCCGGAGAAGACCCATATTCAGAGGGG
Full Trace Sequence: GAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGTTCTTGGTGGGGAGTTTTCATCTGAGGAGGACTGACTGAGAAAGCCCATCTGGAAAGCAAGGACGGCGGGAATTGGAAATCGATCCTTCGGCTTCTTAAACTCATCCTTTTCCTTCCTCAAAACTCGCATCACTTCCACCGGGTTGGTTTTTCCTGTGAATTTCATTACAGCCTCCTCCCTCACTCTCATGAAGGGGTTGTAAAGAAACTCCTCCTCCAGGCTGGAAGGGACAGTAGGAATATCATCTTCATCTCGAGCCTTGGCCCACGCCAGCTTCTCCTTCACCTTCTCATTACTTGGCTCCACCTTAAGCGCAAACTTCAGGTTCCTCACGGTATATTCATGGCCGCAAAATACTTTGGTGTCTTTGGGGAGGGATCCAAGTGTCTCCGACAGGTTCTTGTACATCTGCTCTGCCGTCCCTTCATAAAACATCCCACAGCCTCCGACGAACAGTGTGTCCCTGTGTGTCTGTCCCACCAGCTGCTCCGATAAATCACCTGAAAACAGCGCTGGGGCATCAGGGCAGCCGTCTTCCCATATAAAGAAACACATGTGCCCCGACGTATGAACAGGGGGTGAGAGGCATCTCACGTTTATACCCCCAAACTTCCATTTCTTGGTAATGGAAAAGCTGGGGGGTCGCCCCTCCATCCTGCCCTCCGCCCCCCTACCCTTCCACCTTGGGGGATTCCCTGGAAACAAAACCCGGGTTTCCCTCCGGAAAAGAACCCAGGGGGGTAGAGGGGGGAGCCGGAGAAGACCCATATTCAGAGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGTTCTTGGTGGGGAGTT