ORFeome > hand2 ORF1 – XORFeome v1.0

hand2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hand2
Gene ID: 865126
Gene Page ID: 481425
ORF Xenbase ID: 17278521

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123194
Original XGC clone length: 633

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: A03

Sequences - 5ʹ (forward) EST

Accession: JZ838327
dbEST ID: 79656029
Trimmed Sequence: ATGAGTCTGGTTGGGGGGTTTCCACACCACCCAGTGGTTCACCATGACGGTTATCCCTTTGCAGCTGCGGCAGCTGCAGCCGCCAGTCGCTGCCATGAAGAGAACCCTTATTTTCACGGCTGGCTAATTAGCCACCCCGAAATGTCTCCCCCCGATTACAGCATGGCACCGTCCTACAGCCCGGAGTATGCCAATGGCGCGGCCGGACTGGACCACTCCCATTACGGGGGTGTCCCGGGAAGCGGGGCAGGAGGCTTGATGCAACGGCCTGTAAAGCGAAGGGGAACCGCTAACCGCAAGGAAAGGCGCAGGACTATAAGCATCAACAGCGCCTTCGCAGAGCTGAGGGAGTGTATCCCCAATGTGCCCGCGGATACCAAGCTCTCAAAGATCAAAACTCTGCGGCTGGCCACCAGCTATATAGCCTACCTCATGGACCTGCTGGCCAAAGACGACCAGAATGGCGAGACAGAGGCCTTTAAGGCAGAGATCAAAAAGACAGATGTGAAGGAGGAGAAGAGGAAGAAAGAACTGAATGAACTATTGAAAAGCACAGTTTGCAGTAACGATAAGAAAACCAAAGGCAGGACTGGTTGGCCGCAACATGTCTGGGCTCTGGAGCTTAAACAGTT
Full Trace Sequence: TCGAGGGCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTCTGGTTGGGGGGTTTCCACACCACCCAGTGGTTCACCATGACGGTTATCCCTTTGCAGCTGCGGCAGCTGCAGCCGCCAGTCGCTGCCATGAAGAGAACCCTTATTTTCACGGCTGGCTAATTAGCCACCCCGAAATGTCTCCCCCCGATTACAGCATGGCACCGTCCTACAGCCCGGAGTATGCCAATGGCGCGGCCGGACTGGACCACTCCCATTACGGGGGTGTCCCGGGAAGCGGGGCAGGAGGCTTGATGCAACGGCCTGTAAAGCGAAGGGGAACCGCTAACCGCAAGGAAAGGCGCAGGACTATAAGCATCAACAGCGCCTTCGCAGAGCTGAGGGAGTGTATCCCCAATGTGCCCGCGGATACCAAGCTCTCAAAGATCAAAACTCTGCGGCTGGCCACCAGCTATATAGCCTACCTCATGGACCTGCTGGCCAAAGACGACCAGAATGGCGAGACAGAGGCCTTTAAGGCAGAGATCAAAAAGACAGATGTGAAGGAGGAGAAGAGGAAGAAAGAACTGAATGAACTATTGAAAAGCACAGTTTGCAGTAACGATAAGAAAACCAAAGGCAGGACTGGTTGGCCGCAACATGTCTGGGCTCTGGAGCTTAAACAGTTGCCAACTTTCTTGTAACAAGTTTGCATTAATAAAAAGCATTGCTAATCATTTTTTGGCAACGAAAAGGTCACTAATCATTCAAAAAAAAAATAATTAATTTGCCATCCCACCTAAAAATCCCCCATAATTTTAGTAAAAAAAAAAAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTCTGGTTGGGGGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838326
dbEST ID: 79656028
Trimmed Sequence: CTGTTTTAGCTCCAGAGCCCAGACATGTTGCGGCCAACCAGTCCTGCCTTTGGTTTTCTTATCGTTACTGCAAACTGTGCTTTTCAATAGTTCATTCAGTTCTTTCTTCCTCTTTTCCTCCTTCACATCTGTCTTTTTGATCTCTGCCTTAAAGGCCTCTGTCTCGCCATTCTGGTCGTCTTTGGCCAGCAGGTCCATGAGGTAGGCTATATAGCTGGTGGCCAGCCGCAGAGTTTTGATCTTTGAGAGCTTGGTATCCGCGGGCACATTGGGGATACACTCCCTCAGCTCTGCGAAGGCGCTGTTGATGCTTATAGTCCTGCGCCTTTCCTTGCGGTTAGCGGTTCCCCTTCGCTTTACAGGCCGTTGCATCAAGCCTCCTGCCCCGCTTCCCGGGACACCCCCGTAATGGGAGTGGTCCAGTCCGGCCGCGCCACTGGCATACTCCGGGCTGTAGGACGGTGCCATGCTGTAATCAGGGGGAGACATTTCCGGGGTGGCTAATTAGCCAGCCGTGAAAATAAGGATTCTCTTCATGGCAGCGACTGGCGGCTGCAGCTGCCCCACCTGCAAAGGGAATAACGTCATGGTGAACCACTGGGTGGGTGGGGAGACCACCAAACCCAACTCATGGTGCCAACTTTTTTGTACAATTTTTGGCATTTATATAAAACCAATTGCCTCATCATTTTGTTTGCAACGAAACAGGGGCCCAAACAGTGTCAA
Full Trace Sequence: CGGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGTTTTAGCTCCAGAGCCCAGACATGTTGCGGCCAACCAGTCCTGCCTTTGGTTTTCTTATCGTTACTGCAAACTGTGCTTTTCAATAGTTCATTCAGTTCTTTCTTCCTCTTTTCCTCCTTCACATCTGTCTTTTTGATCTCTGCCTTAAAGGCCTCTGTCTCGCCATTCTGGTCGTCTTTGGCCAGCAGGTCCATGAGGTAGGCTATATAGCTGGTGGCCAGCCGCAGAGTTTTGATCTTTGAGAGCTTGGTATCCGCGGGCACATTGGGGATACACTCCCTCAGCTCTGCGAAGGCGCTGTTGATGCTTATAGTCCTGCGCCTTTCCTTGCGGTTAGCGGTTCCCCTTCGCTTTACAGGCCGTTGCATCAAGCCTCCTGCCCCGCTTCCCGGGACACCCCCGTAATGGGAGTGGTCCAGTCCGGCCGCGCCACTGGCATACTCCGGGCTGTAGGACGGTGCCATGCTGTAATCAGGGGGAGACATTTCCGGGGTGGCTAATTAGCCAGCCGTGAAAATAAGGATTCTCTTCATGGCAGCGACTGGCGGCTGCAGCTGCCCCACCTGCAAAGGGAATAACGTCATGGTGAACCACTGGGTGGGTGGGGAGACCACCAAACCCAACTCATGGTGCCAACTTTTTTGTACAATTTTTGGCATTTATATAAAACCAATTGCCTCATCATTTTGTTTGCAACGAAACAGGGGCCCAAACAGTGTCAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGTTTTAGCTCCAGAGCC