ORFeome > harbi1 ORF1 – XORFeome v1.0

harbi1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: harbi1
Gene ID: 6077434
Gene Page ID: 6077432
ORF Xenbase ID: 17278539

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084846
Original XGC clone length: 1044

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: H02

Sequences - 5ʹ (forward) EST

Accession: JZ839976
dbEST ID: 79657678
Trimmed Sequence: ATGGCCGTACCCATTACTGTCCTGGATTGCGACTTGCTGCTGTATGGCCGAGGGCATCGCACGCTCGACCGATTTCGCCTCGATGATGTCACAGACGATTATCTAGTGACCACTTATGGCTTTCCCAGGCCGTTTATTGATTACCTTGTTGATTTGTTGGGGGCCAGTCTATCACGACCTACACATCGATCTCGCGCAATCAGCCCTGAAACACAGATCATGGCTGCTCTTGGATTCTATACCTCGGGATCCTTCCAGACTCGCATGGGGGATACAATTGGGATCAGCCAAGCTTCCATGAGTCGCTGCGTGACTAACGTCACAGAGGCTCTGGTAGAGAGGGCATCCCAGTTCATCTCCTTCCCTAGAGATGAAAGATCAGTGCAAGGGCTGAAGGATGAATTCTACAATCTGGCAGGGGTTCCTGGAGTTTTGGGGGTGGTAGACTGCACTCAAGTGAATATTAAAGCCCCAAATTCAGAGGACTTGTCCTATGTGAACAGCAGAGGCCTGCACTCCTTAAACTGCTTGCTTGTGTGTGATGCCCGAGGTTCCCTGTTGTGGGCTGAGACCAGTCGTCTGGGCAGCATGCAGGACAATGCGGTGCTTCACCATCAGAGCTCAGCGGCCTGTTTGAAACTTAAATGCACAAACAGGGCTGGCTGCTAGCGGATAATGCCTTCATTCTGCGACCTTGCCTAATGACCCCGGTGCAAATACCAAAAAGCCCATCGAATTAACGCTTAAACCTGGGCCCAAACTGGCCCCCCATAAGGGGGGTGGA
Full Trace Sequence: CGAGGGCCCAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCGTACCCATTACTGTCCTGGATTGCGACTTGCTGCTGTATGGCCGAGGGCATCGCACGCTCGACCGATTTCGCCTCGATGATGTCACAGACGATTATCTAGTGACCACTTATGGCTTTCCCAGGCCGTTTATTGATTACCTTGTTGATTTGTTGGGGGCCAGTCTATCACGACCTACACATCGATCTCGCGCAATCAGCCCTGAAACACAGATCATGGCTGCTCTTGGATTCTATACCTCGGGATCCTTCCAGACTCGCATGGGGGATACAATTGGGATCAGCCAAGCTTCCATGAGTCGCTGCGTGACTAACGTCACAGAGGCTCTGGTAGAGAGGGCATCCCAGTTCATCTCCTTCCCTAGAGATGAAAGATCAGTGCAAGGGCTGAAGGATGAATTCTACAATCTGGCAGGGGTTCCTGGAGTTTTGGGGGTGGTAGACTGCACTCAAGTGAATATTAAAGCCCCAAATTCAGAGGACTTGTCCTATGTGAACAGCAGAGGCCTGCACTCCTTAAACTGCTTGCTTGTGTGTGATGCCCGAGGTTCCCTGTTGTGGGCTGAGACCAGTCGTCTGGGCAGCATGCAGGACAATGCGGTGCTTCACCATCAGAGCTCAGCGGCCTGTTTGAAACTTAAATGCACAAACAGGGCTGGCTGCTAGCGGATAATGCCTTCATTCTGCGACCTTGCCTAATGACCCCGGTGCAAATACCAAAAAGCCCATCGAATTAACGCTTAAACCTGGGCCCAAACTGGCCCCCCATAAGGGGGGTGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCGTACCCATTACT

Sequences - 3ʹ (reverse) EST

Accession: JZ839975
dbEST ID: 79657677
Trimmed Sequence: ACTGAAATGTGTAAGGATTAGCTCCTGCCTCATACGGTAAGCCTCTGACTCTAGTGGTTCCATGTGCACACATTCTTCTTCAGGCTCCAGACTGGTTGCCCCAGACTCGCTTACAATATCAAGGTCGTGCTGCAGAGCAATATTATGCAAAATGCAGCATGCCAATACTATCTGAGCAGATTTTTCAGGGGAATACTGCAGGGTGGCCCTGGACCCATCAAGGCAACGGAAACGTAGTCGGAGGGATCTCTGAGTACGCTCCATCACACTATGCGTGGCAGTGTGCGCCATGTTGTAGCGATAATCCGATGGGCTTTCTGGTATCTGCACCGGTGTCATCAGCCAAGGTCGCAGAATGAAGGCATTATCCGCTAGCAGCCAGCCCTGTTTGTGCATTTTAGTTTCAAACAGGCCGCTGAGCTCTGATTGGTGAAGCACCGCATTGTCCTGCATGCTGCCCAGACGACTGGTCTCAGCCCACAACAGGGAACCTCGGGCATCACACACAAGCAAGCATTTTAAGGAGTGCAGGCCTCTGCTGTTCACATAGGACAAGTCCTCTGAATTTGGGGCTTTAATATTCACTTGAGTGCAGTCTACCACCCCCCAAAACTCCAGGACCCCTGGCCGATTGTAAAAATTATCCCTCCGCCCCTTGCACTGAATCTTCCACCTCTTGGAAAAAGAAAATAAACGGGGGAAATGCCCTCTCTAC
Full Trace Sequence: AAAACTGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACTGAAATGTGTAAGGATTAGCTCCTGCCTCATACGGTAAGCCTCTGACTCTAGTGGTTCCATGTGCACACATTCTTCTTCAGGCTCCAGACTGGTTGCCCCAGACTCGCTTACAATATCAAGGTCGTGCTGCAGAGCAATATTATGCAAAATGCAGCATGCCAATACTATCTGAGCAGATTTTTCAGGGGAATACTGCAGGGTGGCCCTGGACCCATCAAGGCAACGGAAACGTAGTCGGAGGGATCTCTGAGTACGCTCCATCACACTATGCGTGGCAGTGTGCGCCATGTTGTAGCGATAATCCGATGGGCTTTCTGGTATCTGCACCGGTGTCATCAGCCAAGGTCGCAGAATGAAGGCATTATCCGCTAGCAGCCAGCCCTGTTTGTGCATTTTAGTTTCAAACAGGCCGCTGAGCTCTGATTGGTGAAGCACCGCATTGTCCTGCATGCTGCCCAGACGACTGGTCTCAGCCCACAACAGGGAACCTCGGGCATCACACACAAGCAAGCATTTTAAGGAGTGCAGGCCTCTGCTGTTCACATAGGACAAGTCCTCTGAATTTGGGGCTTTAATATTCACTTGAGTGCAGTCTACCACCCCCCAAAACTCCAGGACCCCTGGCCGATTGTAAAAATTATCCCTCCGCCCCTTGCACTGAATCTTCCACCTCTTGGAAAAAGAAAATAAACGGGGGAAATGCCCTCTCTAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTGAAATGTGTAAGGATTAGCTC