ORFeome > haus2 ORF2 – XORFeome v1.0

haus2 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: haus2
Gene ID: 6255719
Gene Page ID: 942551
ORF Xenbase ID: 17278569

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC106272
Original XGC clone length: 666

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: C05

Sequences - 5ʹ (forward) EST

Accession: JZ838008
dbEST ID: 79655710
Trimmed Sequence: ATGGCAGCGAATCCCTGGAGTCCCGTGCAGCCCTCCGCTGCTTCCTTGCTACTAGAGAAATGTTTAGCAGCGGGCGTTTTATCGCAGAATGCCCTTGACCAAGCACAGCTGGAGTCACCATGTTTCAGTCATGCGGAAGAACTCCAAAGAATAACAGAAATCAAGGCTGAGATAAACCAGAAGAGCTTGGAACTGGAATTGCTAAGGCTGGAGAAAGAAACTGCAGATATCACTCATCCTTTATACCTTGGGCAGAAACATCAGGCACTGCAAGCAATGAACAGCCACTTGGAAGCAGTACTTAGGGAAAAACGCTCTTTAAGGCAGAGACTGGCTCAGCCAGTTTGCCAGGAGAATTTGCCCATTGAAGCATCCTATCACAGGTTCACTGCAGAACTATTGCCGCTTGCAGTAAATTTTATTGAAAAGCTGGAAATATATATTAAGACTATCCAAACTATTCCAAAAATTCCAGATTGCGCTAGTAATATGGATAATGCCTTAATGAGGATGGAATCTTTGGAAGCAGAAATGGAGGAGGTGACAGAGCAGATATTGACATGGAGAGAACAGCAGAAGACTGCATTCCAGATGAATTCAGATGCAAATTCCAGTTGTATACCTGCACCGACATCATATTTATCTATTGAAAACCTGCACCCCTTTGCAACTTTTCTTGACAAGTTTGGCTTTTTAGAAAACCATTGCTTTATGTTTTTGTTGCAACGAAACAGGTACATTTACATTTCAAAATAAAATCATTTAATTTTCCACTCCCACCTAAAATACCCCCCTAAAGGTAAGTTGGTATTT
Full Trace Sequence: CGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGCGAATCCCTGGAGTCCCGTGCAGCCCTCCGCTGCTTCCTTGCTACTAGAGAAATGTTTAGCAGCGGGCGTTTTATCGCAGAATGCCCTTGACCAAGCACAGCTGGAGTCACCATGTTTCAGTCATGCGGAAGAACTCCAAAGAATAACAGAAATCAAGGCTGAGATAAACCAGAAGAGCTTGGAACTGGAATTGCTAAGGCTGGAGAAAGAAACTGCAGATATCACTCATCCTTTATACCTTGGGCAGAAACATCAGGCACTGCAAGCAATGAACAGCCACTTGGAAGCAGTACTTAGGGAAAAACGCTCTTTAAGGCAGAGACTGGCTCAGCCAGTTTGCCAGGAGAATTTGCCCATTGAAGCATCCTATCACAGGTTCACTGCAGAACTATTGCCGCTTGCAGTAAATTTTATTGAAAAGCTGGAAATATATATTAAGACTATCCAAACTATTCCAAAAATTCCAGATTGCGCTAGTAATATGGATAATGCCTTAATGAGGATGGAATCTTTGGAAGCAGAAATGGAGGAGGTGACAGAGCAGATATTGACATGGAGAGAACAGCAGAAGACTGCATTCCAGATGAATTCAGATGCAAATTCCAGTTGTATACCTGCACCGACATCATATTTATCTATTGAAAACCTGCACCCCTTTGCAACTTTTCTTGACAAGTTTGGCTTTTTAGAAAACCATTGCTTTATGTTTTTGTTGCAACGAAACAGGTACATTTACATTTCAAAATAAAATCATTTAATTTTCCACTCCCACCTAAAATACCCCCCTAAAGGTAAGTTGGTATTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGCGAATCCCTGGAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838007
dbEST ID: 79655709
Trimmed Sequence: GGGGTGCAGGTTTTCAATAGATAAATATGATGTCTGTGCAGGTATACAACTGGAATTTGCATCTGAATTCATCTGGAATGCAGTCTTCTGCTGTTCTCTCCATGTCAATATCTGCTCTGTCACCTCCTCCATTTCTGCTTCCAAAGATTCCATCCTCATTAAGGCATTATCCATATTACTAGCGCAATCTGGAATTTTTGGAATAGTTTGGATAGTCTTAATATATATTTCCAGCTTTTCAATAAAATTTACTGCAAGCGGCAATAATTCTGCAGTGAACCTGTGATAGGATGCTTCAATGGGCGAATTCTCCTGGCAAACTGGCTGAACCAGTCTCTGCCTTAAAGAGCGTTTTTCCCTAAGTACTGCTTCCAAGTGGCTGTTCATTGCTTGCAGTGCCTGATGTTTCTGCCCAAGGTATAAAGGATGAGTGATATATGCAGTTTCTTTCTCCACCCTTAGCAATTCCCGTTCCAAGCTCTTCTGGTTTATGTGAGCCTTGATTTCTGTTATTCGTTTGAAATTAGTACGCACGAACTGGAAGATGGGGACGTCGGGCTCTTCTTGTTGGAGGGGCGGGCTGCGATAACACGCATCCTCCTTACCGTTTTCTCTATACCCAAGAAGACGGCGGAAGGCTGAGGGGGGGGACAAGGGAGACGCGCCGTGGTCCCGGGCTGTGTGGTACTTTTTAGGGGTGTGAGAAGAAGATTTGTATATAAATTTGTTTGTGTCTNNGGTTGGAAAAAAAAAAAAAGAAAAAAAAAAAAAAAAAAAAAAA
Full Trace Sequence: AAAATGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGGGTGCAGGTTTTCAATAGATAAATATGATGTCTGTGCAGGTATACAACTGGAATTTGCATCTGAATTCATCTGGAATGCAGTCTTCTGCTGTTCTCTCCATGTCAATATCTGCTCTGTCACCTCCTCCATTTCTGCTTCCAAAGATTCCATCCTCATTAAGGCATTATCCATATTACTAGCGCAATCTGGAATTTTTGGAATAGTTTGGATAGTCTTAATATATATTTCCAGCTTTTCAATAAAATTTACTGCAAGCGGCAATAATTCTGCAGTGAACCTGTGATAGGATGCTTCAATGGGCGAATTCTCCTGGCAAACTGGCTGAACCAGTCTCTGCCTTAAAGAGCGTTTTTCCCTAAGTACTGCTTCCAAGTGGCTGTTCATTGCTTGCAGTGCCTGATGTTTCTGCCCAAGGTATAAAGGATGAGTGATATATGCAGTTTCTTTCTCCACCCTTAGCAATTCCCGTTCCAAGCTCTTCTGGTTTATGTGAGCCTTGATTTCTGTTATTCGTTTGAAATTAGTACGCACGAACTGGAAGATGGGGACGTCGGGCTCTTCTTGTTGGAGGGGCGGGCTGCGATAACACGCATCCTCCTTACCGTTTTCTCTATACCCAAGAAGACGGCGGAAGGCTGAGGGGGGGGACAAGGGAGACGCGCCGTGGTCCCGGGCTGTGTGGTACTTTTTAGGGGTGTGAGAAGAAGATTTGTATATAAATTTGTTTGTGTCTNNGGTTGGAAAAAAAAAAAAAGAAAAAAAAAAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGGGTGCAGGTTTTCAAT