ORFeome > haus8 ORF1 – XORFeome v1.0

haus8 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: haus8
Gene ID: 5797188
Gene Page ID: 5797182
ORF Xenbase ID: 17278587

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123131
Original XGC clone length: 1104

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: A01

Sequences - 5ʹ (forward) EST

Accession: JZ838038
dbEST ID: 79655740
Trimmed Sequence: ATGTCGGAAGCTGGAGTTGCTCCCATTGAAGATGGGTCTCAGAACAGCTCAGGAGGCAGTAGTGGAGATGCAGCACTTAAAAAAAGCAAAGGAGGAGCAAAGGTTGTAAAATCACGTTACATGCAAATTGGCAGGAGCAAGGTTTCAAAGAATAGTTTGGCCAACACAACAGTCTGCTCAGGTGGTAAAGTCCCAGAGAGAGGAAGTGGAGGAACGCCAACACGCAGATCTTTAGCACCTCACAAGGCAAAGATTACAGCAGCTGTGCCTTTACCTGCTCTTGATGGAAGCATATTTACAAAAGAAGATCTGCAGTCTACTTAGTTGGATGGCCACAGGATTGCCCGTCCGGATCTGGACCTATCTGTTATTAATGATAGAACTTTGCAGAAAATTACCCCAAGGCCAGTTGTGACTTCAGAACAGAAAAAGCCTAAAAGAGACACCACCCCTGTAAACCTTGTGCCTGAAGATATGGTAGAGATGATTGAGTCACAGACATTGCTGTTAACATATCTNACCATAAAAATGCAGAAAAATCTGTTTCGCCTGGAAGAGAAGGCTGAGAGGAATCTTCTTCTAGTAAATGACCAAAAGGATCAACTGCAGGAGACGATACACATGATGAAAAGGGACCTAACCTTGCTGCATAGGGAAAAAAGGCTAAGGGATTTGATTGAAAAGCCAGAAGAAGTTCTCACGCCCGGTTGTTACTTCCAGGGACCCACTTCAAGGGACAATTATAAAAACATTGGCAACCAGCCCCGGGAACCCCGCCAGGAAATCCAACCCTGGGCTTTTAAAAAAAATATTTCCAAT
Full Trace Sequence: CTCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCGGAAGCTGGAGTTGCTCCCATTGAAGATGGGTCTCAGAACAGCTCAGGAGGCAGTAGTGGAGATGCAGCACTTAAAAAAAGCAAAGGAGGAGCAAAGGTTGTAAAATCACGTTACATGCAAATTGGCAGGAGCAAGGTTTCAAAGAATAGTTTGGCCAACACAACAGTCTGCTCAGGTGGTAAAGTCCCAGAGAGAGGAAGTGGAGGAACGCCAACACGCAGATCTTTAGCACCTCACAAGGCAAAGATTACAGCAGCTGTGCCTTTACCTGCTCTTGATGGAAGCATATTTACAAAAGAAGATCTGCAGTCTACTTAGTTGGATGGCCACAGGATTGCCCGTCCGGATCTGGACCTATCTGTTATTAATGATAGAACTTTGCAGAAAATTACCCCAAGGCCAGTTGTGACTTCAGAACAGAAAAAGCCTAAAAGAGACACCACCCCTGTAAACCTTGTGCCTGAAGATATGGTAGAGATGATTGAGTCACAGACATTGCTGTTAACATATCTNACCATAAAAATGCAGAAAAATCTGTTTCGCCTGGAAGAGAAGGCTGAGAGGAATCTTCTTCTAGTAAATGACCAAAAGGATCAACTGCAGGAGACGATACACATGATGAAAAGGGACCTAACCTTGCTGCATAGGGAAAAAAGGCTAAGGGATTTGATTGAAAAGCCAGAAGAAGTTCTCACGCCCGGTTGTTACTTCCAGGGACCCACTTCAAGGGACAATTATAAAAACATTGGCAACCAGCCCCGGGAACCCCGCCAGGAAATCCAACCCTGGGCTTTTAAAAAAAATATTTCCAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGGAAGCTGGAGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ838037
dbEST ID: 79655739
Trimmed Sequence: AGGTAGGGATCCATCAAAATACCACTGCCTCACCAAAGCTGATTCACAAGTCTCCTCGACTGCTTTCTGGCTTTGTAATGAAATTTCCTTATTGACTTTGAATGACAAGTCAAGAATCTGGCGAAAACTCCGTGCACCTACTTCATCTGTTTTGATCACAATATTTTCCAAGTCCTTTATTGTATCAGATGATTCTGCATTTTCACTGACATGGCTTGGCATTATTTCTTCCAGAACGGATTTGGTAATGGCTAAATGTTTTTGGAGTTCCTCTACGTATCTGTGACGGTTGCCTGAAATATGAATATTCTTAATAGCCAGTTGATGTCTAGTAGAGTCCAGGGCTGTGGCAAATGTTGTATAATTGTCCTTGAATGGGTCCTTGGAAGTAACAACACGCGTGAGAACTTCATCCTGCTTCTCAATCAAATACCTAAGCCTCTCTTCCCTCTGCAGCAAGGTTAGGTCCCTTTTCTTCATGTGTAGCGTCGCCTGCAGTTGAGTCCTTTTGTCATTTACTAAAAGAAAATTCATCTCACCCCTTCTCTTCACGCGAGGCAGATTTTTCTTCATTTTTATGTTTAAATAGGTTAATACCAAATACTGTAACTCGAGGATCTCTACTATATCTTACGGCACGGGGCTGAGCAGGGGGGGGGGGGCGCGTGCGGGGTTTTTCTTTGTTCTGATGTTTCAAAATCCCACTGGAGCTGGGGGGGGCTGGCGGGGGCCGATTCCGGCCCAAAGCAGAATAAATTTACAAATTCAAAAAAAAAGACACGC
Full Trace Sequence: GAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGGTAGGGATCCATCAAAATACCACTGCCTCACCAAAGCTGATTCACAAGTCTCCTCGACTGCTTTCTGGCTTTGTAATGAAATTTCCTTATTGACTTTGAATGACAAGTCAAGAATCTGGCGAAAACTCCGTGCACCTACTTCATCTGTTTTGATCACAATATTTTCCAAGTCCTTTATTGTATCAGATGATTCTGCATTTTCACTGACATGGCTTGGCATTATTTCTTCCAGAACGGATTTGGTAATGGCTAAATGTTTTTGGAGTTCCTCTACGTATCTGTGACGGTTGCCTGAAATATGAATATTCTTAATAGCCAGTTGATGTCTAGTAGAGTCCAGGGCTGTGGCAAATGTTGTATAATTGTCCTTGAATGGGTCCTTGGAAGTAACAACACGCGTGAGAACTTCATCCTGCTTCTCAATCAAATACCTAAGCCTCTCTTCCCTCTGCAGCAAGGTTAGGTCCCTTTTCTTCATGTGTAGCGTCGCCTGCAGTTGAGTCCTTTTGTCATTTACTAAAAGAAAATTCATCTCACCCCTTCTCTTCACGCGAGGCAGATTTTTCTTCATTTTTATGTTTAAATAGGTTAATACCAAATACTGTAACTCGAGGATCTCTACTATATCTTACGGCACGGGGCTGAGCAGGGGGGGGGGGGCGCGTGCGGGGTTTTTCTTTGTTCTGATGTTTCAAAATCCCACTGGAGCTGGGGGGGGCTGGCGGGGGCCGATTCCGGCCCAAAGCAGAATAAATTTACAAATTCAAAAAAAAAGACACGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGGTAGGGATCCATCAAAATACCA