ORFeome > hba3 ORF1 – XORFeome v1.0

hba3 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: hba3
Gene ID: 973877
Gene Page ID: 973869
ORF Xenbase ID: 17278617

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054259
Original XGC clone length: 429

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: H10

Sequences - 5ʹ (forward) EST

Accession: JZ839568
dbEST ID: 79657270
Trimmed Sequence: ATGACTCTGACCGACAGTGATAAGGCTGCAGTTGTTGCTCTGTGGGGCAAAATCGCACCCCAAGCTAATGCCATTGGAGCTGAGGCTTTGGAGAGACTTTTCCTGTCCTATCCCCAGACCAAGACTTACTTCAGCCACTTTGATCTGTCTCATGGCTCTGCTGATCTTGCCAACCACGGAGGAAAGGTTGTGAATGCTCTTGGAGAAGCTGCCAAGCACATCAATGACCTGGATGCTGCTCTGTCCACACTCAGTGACCTGCATGCCTACAACCTGAGAGTGGATCCTGGAAACTTCAAGTTGCTGTCTCACACCATCCAGGTGACTCTGGCCATCCACTTCCATAAGGAATTTGATGCTGCCACCCATGCTGCTTGGGACAAATTCCTGGCTGAGGTTGCCACCGTCCTCACCTCCAAGTACAGATT
Full Trace Sequence: GCCACCAAATAATAGATTTTATTTTCGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTCTGACCGACAGTGATAAGGCTGCAGTTGTTGCTCTGTGGGGCAAAATCGCACCCCAAGCTAATGCCATTGGAGCTGAGGCTTTGGAGAGACTTTTCCTGTCCTATCCCCAGACCAAGACTTACTTCAGCCACTTTGATCTGTCTCATGGCTCTGCTGATCTTGCCAACCACGGAGGAAAGGTTGTGAATGCTCTTGGAGAAGCTGCCAAGCACATCAATGACCTGGATGCTGCTCTGTCCACACTCAGTGACCTGCATGCCTACAACCTGAGAGTGGATCCTGGAAACTTCAAGTTGCTGTCTCACACCATCCAGGTGACTCTGGCCATCCACTTCCATAAGGAATTTGATGCTGCCACCCATGCTGCTTGGGACAAATTCCTGGCTGAGGTTGCCACCGTCCTCACCTCCAAGTACAGATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTAATATCCCCTATAGTGAGTCGAATTACATGGGTCATAGCAAAAAACTGGCAACACTGGCCCTTGTCTCAGATCTCGGAAATGTAACAGAGAAAAAAAAGCACAGGTCCCTGCAAACCTGGGGTCTTGGGTTAACTGGTCGTGTAACGGGAAAGGGCCCAGACCAGGGAAAAAAAAAAGAAAACAAAATAAAACGAAAGAAGACGAGAAACGGACACGGACCCCGGGGCCAAAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTCTGACCGACAGTGATAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839567
dbEST ID: 79657269
Trimmed Sequence: TCTGTACTTGGAGGTGAGGACGGTGGCAACCTCAGCCAGGAATTTGTCCCAAGCAGCAGGGGTGGCAGCATCAAATTCCTTATGGAAGTGGATGGCCAAAGTCACCTGGATGGTGTGAAACAGCAACTTGAAGTTTCCAGGATCCACTCTCAGGTTGTAGGCATGCAGGTCACTGAGTGTGGACAGAGCACCATCCAGGTCATTGATGTGCTTGGCACCTTCTCCAAAAGCATTCACAACCTTTCCTCCGTGGTTGGCAAAATCACCAAAGCCTTGAAACAAATCAAAGTGGCTAAAGTAATTCTTGGTCTGGGGATAGGACAGGAAAAGTCTCTCCAAACCCTCACCTCCAATGGCATTAGCTTGGGGTGCAATTTTGCCCCAGATAGCAACAACTGCAGCCTTAACACTGTCGGTCAAATTCATGGGGGCCACTTTTTTGTACAAATTTGGCTTTATAAAAAAACATTGCTCATCCTTTTTTTGCAACAAACAGGTCACTAATCAGTCAAAATAAGATCATTTATTTGAAAAAAAAAAAAAAAGACAAACAAAACAAAAACCCCAGGCCACGCAAAGGGCGCCGGGAAGAAAAAGCCAACGGGCTCCCCCGTACCATGGGGCCCTGGTTGACTCCGTTGGGTGAAAGGGAAAAGGGCCCAAAACAAAGGAAAAAAAACCGGGTA
Full Trace Sequence: GGGAAAAATGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCTGTACTTGGAGGTGAGGACGGTGGCAACCTCAGCCAGGAATTTGTCCCAAGCAGCAGGGGTGGCAGCATCAAATTCCTTATGGAAGTGGATGGCCAAAGTCACCTGGATGGTGTGAAACAGCAACTTGAAGTTTCCAGGATCCACTCTCAGGTTGTAGGCATGCAGGTCACTGAGTGTGGACAGAGCACCATCCAGGTCATTGATGTGCTTGGCACCTTCTCCAAAAGCATTCACAACCTTTCCTCCGTGGTTGGCAAAATCACCAAAGCCTTGAAACAAATCAAAGTGGCTAAAGTAATTCTTGGTCTGGGGATAGGACAGGAAAAGTCTCTCCAAACCCTCACCTCCAATGGCATTAGCTTGGGGTGCAATTTTGCCCCAGATAGCAACAACTGCAGCCTTAACACTGTCGGTCAAATTCATGGGGGCCACTTTTTTGTACAAATTTGGCTTTATAAAAAAACATTGCTCATCCTTTTTTTGCAACAAACAGGTCACTAATCAGTCAAAATAAGATCATTTATTTGAAAAAAAAAAAAAAAGACAAACAAAACAAAAACCCCAGGCCACGCAAAGGGCGCCGGGAAGAAAAAGCCAACGGGCTCCCCCGTACCATGGGGCCCTGGTTGACTCCGTTGGGTGAAAGGGAAAAGGGCCCAAAACAAAGGAAAAAAAACCGGGTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCTGTACTTGGAGGTGAGG