ORFeome > hba4 ORF1 – XORFeome v1.0

hba4 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: hba4
Gene ID: 6255815
Gene Page ID: 956172
ORF Xenbase ID: 17278623

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053833
Original XGC clone length: 429

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: B12

Sequences - 5ʹ (forward) EST

Accession: JZ839150
dbEST ID: 79656852
Trimmed Sequence: ATGACTCTGACCGACAGTGATAAGGCTGCAATTGTTGCTCTGTGGGGCAAAATCGCACCCCAAGCTAGTGCCATTGGAGCTGAGGCTTTGGAGAGACTTTTCCTTTCCTATCCCCAGACCAAGACTTACTTCAGCCACTTTGATGTGTCTCATGGCTCTGCTGATCTTTCCAACCACGGAGGAAAGGTTGTGAACGCTCTTGGAGAAGCTGCCAAGCACATCGATGACCTGGATTCTGCTCTGTCCACACTCAGTGACCTGCATGCCTACAACCTGAGAATAGATCCTGGAAACTTCAAGTTGCTGTCTCACACCATCCAGGTGACTCTGGCCATCCACTTCCACAAGGAGTTTGATGCTGCCACACAGGCTGCTTGGGACAAATTCCTGGCTGAGGTTGCCACCGTCCTCACCTCCNAGTACAGATT
Full Trace Sequence: GGGCGTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTCTGACCGACAGTGATAAGGCTGCAATTGTTGCTCTGTGGGGCAAAATCGCACCCCAAGCTAGTGCCATTGGAGCTGAGGCTTTGGAGAGACTTTTCCTTTCCTATCCCCAGACCAAGACTTACTTCAGCCACTTTGATGTGTCTCATGGCTCTGCTGATCTTTCCAACCACGGAGGAAAGGTTGTGAACGCTCTTGGAGAAGCTGCCAAGCACATCGATGACCTGGATTCTGCTCTGTCCACACTCAGTGACCTGCATGCCTACAACCTGAGAATAGATCCTGGAAACTTCAAGTTGCTGTCTCACACCATCCAGGTGACTCTGGCCATCCACTTCCACAAGGAGTTTGATGCTGCCACACAGGCTGCTTGGGACAAATTCCTGGCTGAGGTTGCCACCGTCCTCACCTCCNAGTACAGATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGAAAAATAAAGCCCGAGTCTAAAATCTCTGATGTTAAAACCNNNGNGNNNGTNTGGCNCCGGTTCNTTGGNNCCCGGGGCCCCCGGGTTTTCTCCTGTTTTCCTGGTGGCCCCGGAAAAAAAAAAGAAAAAAACCCGTGGACCATTATAAAACTTGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTCTGACCGACAGTGATAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839149
dbEST ID: 79656851
Trimmed Sequence: TCTGTACTTGGAGGTGAGGACGGTGGCAACCTCAGCCAGGAATTTGTCCCAAGCAGCCTGTGTGGCAGCATCAAACTCCTTGTGGAAGTGGATGGCCAGAGTCACCTGGATGGTGTGAGACAGCAACTTGAAGTTTCCAGGATCTATTCTCAGGTTGTAGGCATGCAGGTCACTGAGTGTGGACAGAGCAGAATCCAGGTCATCGATGTGCTTGGCAGCTTCTCCAAAAGCGTTCACAACCTTTCCTCCGTGGTTGGAAAGATCAGCAGAGCCATGAGACACATCAAAGTGGCTGAAGTAAGTCTTGGTCTGGGGATAGGAAAGGAAAAGTCTCTCCAAAGCCTCAGCTCCAATGGCACTAGCTTGGGGTGCGATTTTGCCCCACAGAGCAACAATTGCAGCCTTATCACTGTCGGTCAGAGTCATGG
Full Trace Sequence: GCCGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCTGTACTTGGAGGTGAGGACGGTGGCAACCTCAGCCAGGAATTTGTCCCAAGCAGCCTGTGTGGCAGCATCAAACTCCTTGTGGAAGTGGATGGCCAGAGTCACCTGGATGGTGTGAGACAGCAACTTGAAGTTTCCAGGATCTATTCTCAGGTTGTAGGCATGCAGGTCACTGAGTGTGGACAGAGCAGAATCCAGGTCATCGATGTGCTTGGCAGCTTCTCCAAAAGCGTTCACAACCTTTCCTCCGTGGTTGGAAAGATCAGCAGAGCCATGAGACACATCAAAGTGGCTGAAGTAAGTCTTGGTCTGGGGATAGGAAAGGAAAAGTCTCTCCAAAGCCTCAGCTCCAATGGCACTAGCTTGGGGTGCGATTTTGCCCCACAGAGCAACAATTGCAGCCTTATCACTGTCGGTCAGAGTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAGTTGGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGTCCAGACAAAAAGACTGGCCTGTCATTTAACACGCCTTGGACTGGGCAGNTNNCCNGAAACCCCTACCGCGTGTCTCNNATTCGNNGATGGTTTAACNNNNANNNTNTGANGTTGNATAAAGAAAAAAAAAAATAGTGNNATAATTNGNNGAATTNTNNNANNATGTGGNNNNNNNGGGTTGGNNGGAGNNGGGAATGNNCCGGNNNATN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCTGTACTTGGAGGTGAGG