ORFeome > hbe1 ORF1 – XORFeome v1.0

hbe1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: hbe1
Gene ID: 6078802
Gene Page ID: 5722134
ORF Xenbase ID: 17278641

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078515
Original XGC clone length: 444

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: E08

Sequences - 5ʹ (forward) EST

Accession: JZ839846
dbEST ID: 79657548
Trimmed Sequence: ATGGTCCACCTGTCAGCTGATGAGAAATCCGCCATTAACGCCGTATGGTCCAAGGTCAGCATTGAAAATGATGGCCATGATGCCCTCACCAGGCTGCTGGTTGTCTACCCCTGGACCCAGAGGTATTTCAGCAGCTTCGGAAACCTCTCCAATGTGGCTGCCATCTCTGGAAATGCCAAGGTTCGTGCCCATGGCAAGAAGGTTTTGTCTTCTGTTGATGAAGCCATCCACCATATAGATGATGTCAAGCACTTCCTTTCCAGTCTGAGCAAGAAACACGCTCAGGAACTCCACGTGGACCCCGAAAACTTCAAGCGTCTTGCTGATGTGCTTGTTATTGTCTTGGCTGGCAAACTGGGAGCTTCCTTCACTCCTCAAGTTCAAGCTGCCTGGGAGAAGTTCAGCGCTGGACTGGTGGCTGCTCTTAGCCATGGCTACTTCTT
Full Trace Sequence: CTCGGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTCCACCTGTCAGCTGATGAGAAATCCGCCATTAACGCCGTATGGTCCAAGGTCAGCATTGAAAATGATGGCCATGATGCCCTCACCAGGCTGCTGGTTGTCTACCCCTGGACCCAGAGGTATTTCAGCAGCTTCGGAAACCTCTCCAATGTGGCTGCCATCTCTGGAAATGCCAAGGTTCGTGCCCATGGCAAGAAGGTTTTGTCTTCTGTTGATGAAGCCATCCACCATATAGATGATGTCAAGCACTTCCTTTCCAGTCTGAGCAAGAAACACGCTCAGGAACTCCACGTGGACCCCGAAAACTTCAAGCGTCTTGCTGATGTGCTTGTTATTGTCTTGGCTGGCAAACTGGGAGCTTCCTTCACTCCTCAAGTTCAAGCTGCCTGGGAGAAGTTCAGCGCTGGACTGGTGGCTGCTCTTAGCCATGGCTACTTCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAATCGTATTACATTGGTTATAGCAAAAAACATGACACTCTAGCCCGTGTCTCAAACTCCCTCTAGCTATAAAAAAAAAAAGACGGGCCTTCCGGGCAACGGGGCTTCCCGGGTTACCTTTCCTGTGGGGGGAATCAGCCAGAAACAAAAAGAAAAAAAGAGGAGAATTAAAAGTTGAAGAAAAAACATAATAGGGCGCCCACCATTGCCCAAAACCTGACAAAACCGAGGGGTGAAGGCGGCGTCTGGGCGGGTTCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTCCACCTGTCAGC

Sequences - 3ʹ (reverse) EST

Accession: JZ839845
dbEST ID: 79657547
Trimmed Sequence: GAAGTAGCCATGGCTAAGAGCAGCCACCAGTCCAGCGCTGAACTTCTCCCAGGCAGCTTGAACTTGAGGAGTGAAGGAAGCTCCCAGTTTGCCAGCCAAGACAATAACAAGCACATCAGCAAGACGCTTGAAGTTTTCGGGGTCCACGTGGAGTTCCTGAGCGTGTTTCTTGCTCAGACTGGAAAGGAAGTGCTTGACATCATCTATATGGTGGATGGCTTCATCAACAGAAGACAAAACCTTCTTGCCATGGGCACGAACCTTGGCATTTCCAGAGATGGCAGCCACATTGGAGAGGTTTCCGAAGCTGCTGAAATACCTCTGGGTCCAGGGGTAGACAACCAGCAGCCTGGTGAGGGCATCATGGCCATCATTTTCAATGCTGACCTTGGACCATACGGCGTTAATGGCGGATTTCTCATCAGCTGACAGGTGGACCATGG
Full Trace Sequence: GAAACTGTCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAGTAGCCATGGCTAAGAGCAGCCACCAGTCCAGCGCTGAACTTCTCCCAGGCAGCTTGAACTTGAGGAGTGAAGGAAGCTCCCAGTTTGCCAGCCAAGACAATAACAAGCACATCAGCAAGACGCTTGAAGTTTTCGGGGTCCACGTGGAGTTCCTGAGCGTGTTTCTTGCTCAGACTGGAAAGGAAGTGCTTGACATCATCTATATGGTGGATGGCTTCATCAACAGAAGACAAAACCTTCTTGCCATGGGCACGAACCTTGGCATTTCCAGAGATGGCAGCCACATTGGAGAGGTTTCCGAAGCTGCTGAAATACCTCTGGGTCCAGGGGTAGACAACCAGCAGCCTGGTGAGGGCATCATGGCCATCATTTTCAATGCTGACCTTGGACCATACGGCGTTAATGGCGGATTTCTCATCAGCTGACAGGTGGACCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCAAAACCTTAAGACTGGACGTCATTTACACGCACCGTGAACTGGGATGTTCCAGGGCAGCTTCTGCCCGGTTTCTAGAAGTCCCGTGAGTCTAACAACNNGGAAGGGAAGAATGCCCTGAACCGGGAGAACAAAAAAAAAAAAGATACAAAGCTTGTTAAAAAATATCCAAAGAGCGCGAAAACAAGGGATGAACACCTTGACCNAAN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAGTAGCCATGGCTAAGA