ORFeome > hddc2 ORF1 – XORFeome v1.0

hddc2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: hddc2
Gene ID: 953495
Gene Page ID: 953490
ORF Xenbase ID: 17278731

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078480
Original XGC clone length: 606

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: G02

Sequences - 5ʹ (forward) EST

Accession: JZ839724
dbEST ID: 79657426
Trimmed Sequence: ATGGCTGCTGCCGGTAGCTGCTCTAGTGCAGGGAAGAGCTTGCTGCAATTCATGAAACTTGTAGGGCAGCTCAAGAGAGTCCCTAGGACTGGCTGGATATACCGACAAGTGGAGAAACCAGAAAGCGTGTCAGACCACATGTACAGGATGGCAGTTATGGCAATGCTAACTGAAGACAGAAAACTAAATAAAGACAGATGTATTAGGCTTGCTCTTGTGCATGACATGGCAGAGTGCATTGTGGGTGACATTGCTCCTGCTGACAATATCGCTAAAGAAGAGAAACATAGAAAAGAAAAGGCTGCCATGGAGCATCTCACACAACTTTTACCAGACAACTTGAAGACAGAGGTGTATGATTTATGGGAGGAGTATGAACACCAGTTCACAGCTGAAGCCAAGTTTGTGAAAGAATTAGACCAGTGTGAGATGATACTTCAGGCTCTAGAGTATGAAGAATTGGAGAAAAGACCAGGAAGGCTCCAGGACTTTTATAATTCAACAGCAGGGAAATTTAAGCACCCGGAAATTGTCCAGCTTGTTTCAGCAATCTACGAGGAAAGAAACAGTGCTATAGCAGAAAATGCTCGTACTTCTCAGACTTT
Full Trace Sequence: CGCGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGCTGCCGGTAGCTGCTCTAGTGCAGGGAAGAGCTTGCTGCAATTCATGAAACTTGTAGGGCAGCTCAAGAGAGTCCCTAGGACTGGCTGGATATACCGACAAGTGGAGAAACCAGAAAGCGTGTCAGACCACATGTACAGGATGGCAGTTATGGCAATGCTAACTGAAGACAGAAAACTAAATAAAGACAGATGTATTAGGCTTGCTCTTGTGCATGACATGGCAGAGTGCATTGTGGGTGACATTGCTCCTGCTGACAATATCGCTAAAGAAGAGAAACATAGAAAAGAAAAGGCTGCCATGGAGCATCTCACACAACTTTTACCAGACAACTTGAAGACAGAGGTGTATGATTTATGGGAGGAGTATGAACACCAGTTCACAGCTGAAGCCAAGTTTGTGAAAGAATTAGACCAGTGTGAGATGATACTTCAGGCTCTAGAGTATGAAGAATTGGAGAAAAGACCAGGAAGGCTCCAGGACTTTTATAATTCAACAGCAGGGAAATTTAAGCACCCGGAAATTGTCCAGCTTGTTTCAGCAATCTACGAGGAAAGAAACAGTGCTATAGCAGAAAATGCTCGTACTTCTCAGACTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTAATCATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAATTCATTTATTTGCCATCCGCCTGATATCCCCAATATTGAATCGTAATAAATTGGTCATAGCTGATTCAGGACAAACTCGAGACCAGGCCAAAAAACTCTCCCTTAAAGGTTTAAAAANNGN
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGCTGCCGGTAGCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ839723
dbEST ID: 79657425
Trimmed Sequence: AGTCTGAGAAGTACGAGCATTTTCTGCCAAAACCACTGTTTCTTTCCTCGTAGATTGCTGAAACAAGCTGGACAATTTCCGGGTGCTTAAATTTCCCTGCTGTTGAATTATAAAAGTCCTGGAGCCTTCCTGGTCTTTTCTCCAATTCTTCATACTCTAGAGCCTGAAGTATCATCTCACACTGGTCTAATTCTTTCACAAACTTGGCTTCAGCTGTGAACTGGTGTTCATACTCCTCCCATAAATCATACACCTCTGTCTTCAAGTTGTCTGGTAAAAGTTGTGTGAGATGCTCCATGGCAGCCTTTTCTTTTCTATGTTTCTCTTCTTTATCGATATTGTCAGCAGGAGCAATGTCACCCACAATGCAGTCTGCCATGTCATGCACAAGAACAAGCCTAATACATCTGTCTTTATTTAATTTTCTGTCTTCAGTTAACATTGCCATAACTGCCATCCTGTAGGGGTGGTCTGACACGCTTTCTGGTGTCTCCACTTGTCCGGTAATCCAGGCCGGGCCTAACGACTCTCTTGATCTCCGCTACGAGGTTCATGAATTAAAGGGGGCTCTGCGGGCCGGGGGGGGGGTACTGGGGACAGCATGGGGTCGGGGGTTGGGGGTATTTGGGGTTATAAAGAAAATTGGTTCNTCNNAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAAACAATATTAAAAAGCCCGCGGGGGGAAGAAACGCACCCCTTTCGCAGGCCCCCCTGACGGGGGGGGGGAAGGGGGAGAGAAAAAG
Full Trace Sequence: GAAGATGTCTTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGTCTGAGAAGTACGAGCATTTTCTGCCAAAACCACTGTTTCTTTCCTCGTAGATTGCTGAAACAAGCTGGACAATTTCCGGGTGCTTAAATTTCCCTGCTGTTGAATTATAAAAGTCCTGGAGCCTTCCTGGTCTTTTCTCCAATTCTTCATACTCTAGAGCCTGAAGTATCATCTCACACTGGTCTAATTCTTTCACAAACTTGGCTTCAGCTGTGAACTGGTGTTCATACTCCTCCCATAAATCATACACCTCTGTCTTCAAGTTGTCTGGTAAAAGTTGTGTGAGATGCTCCATGGCAGCCTTTTCTTTTCTATGTTTCTCTTCTTTATCGATATTGTCAGCAGGAGCAATGTCACCCACAATGCAGTCTGCCATGTCATGCACAAGAACAAGCCTAATACATCTGTCTTTATTTAATTTTCTGTCTTCAGTTAACATTGCCATAACTGCCATCCTGTAGGGGTGGTCTGACACGCTTTCTGGTGTCTCCACTTGTCCGGTAATCCAGGCCGGGCCTAACGACTCTCTTGATCTCCGCTACGAGGTTCATGAATTAAAGGGGGCTCTGCGGGCCGGGGGGGGGGTACTGGGGACAGCATGGGGTCGGGGGTTGGGGGTATTTGGGGTTATAAAGAAAATTGGTTCNTCNNAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAAACAATATTAAAAAGCCCGCGGGGGGAAGAAACGCACCCCTTTCGCAGGCCCCCCTGACGGGGGGGGGGAAGGGGGAGAGAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGTCTGAGAAGTACGAGCAT