ORFeome > heatr2 ORF1 – XORFeome v1.0

heatr2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: heatr2
Gene ID: 5902240
Gene Page ID: 5902234
ORF Xenbase ID: 17278773

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC126027
Original XGC clone length: 2520

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: A01

Sequences - 5ʹ (forward) EST

Accession: JZ837596
dbEST ID: 79655298
Trimmed Sequence: ATGGCGGCGGAGGGTGAGCAGCGTGCGACTTCCGATGTGACTAAGGCCCTGGCTCGGCATCTCAATTGCCTTAACGATGAGAATAAAATGATTAGAAGGAGGGCACTGGCTGCTATACAGAAGGAAGCCGCGGATGAGAAGCTGGCCAGCGCTGTTCTGCAGCATGTTTTCTTAGAGTTGCTAAAACCCTTACTCCGGTGCCTGTCAGACCCCATGGAGAAATGTCGGGAGTTGTCTATCCAAATCATAGTGTATTGCGTCAGTCACGTGCCCAGGCCGGAGGAAGCCTTGCCCTACTTGATGCCAGCCCTCACACAGCGCCTGGGCCAACAGCAACTTGTAGAACTTTCTGAGGAGCTCAGACTGGCAATGGTCGAGCTCTTGACTCTGCTCGTGGAGGTTTGTGGGAAGAAGTTGGCCCCTTACCTGGATGAAATGATTCAAATTTTTCAGAGAACGATGGTAGATCCCTTCCCAGACGTGAAGAAAGAGAGCTGCAAGTGTGCCTCCAACTATGCCACATGTATACCAGAGCATTTTCACATGCAGGCAGAGTCATTGATTAAGCCCCTGATGCAAACTATTTCACACCAACATTCTAAAGTGCGTGTCGCTGTTATTCAGACAACTGGAACAGTTATACAGTACAGCAGTGGGAAGTCTGTGGAATGATGTTTTGTCTCATCTTGGCCAGCAACTTTTTTGAT
Full Trace Sequence: CGGGGCCCCAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCGGAGGGTGAGCAGCGTGCGACTTCCGATGTGACTAAGGCCCTGGCTCGGCATCTCAATTGCCTTAACGATGAGAATAAAATGATTAGAAGGAGGGCACTGGCTGCTATACAGAAGGAAGCCGCGGATGAGAAGCTGGCCAGCGCTGTTCTGCAGCATGTTTTCTTAGAGTTGCTAAAACCCTTACTCCGGTGCCTGTCAGACCCCATGGAGAAATGTCGGGAGTTGTCTATCCAAATCATAGTGTATTGCGTCAGTCACGTGCCCAGGCCGGAGGAAGCCTTGCCCTACTTGATGCCAGCCCTCACACAGCGCCTGGGCCAACAGCAACTTGTAGAACTTTCTGAGGAGCTCAGACTGGCAATGGTCGAGCTCTTGACTCTGCTCGTGGAGGTTTGTGGGAAGAAGTTGGCCCCTTACCTGGATGAAATGATTCAAATTTTTCAGAGAACGATGGTAGATCCCTTCCCAGACGTGAAGAAAGAGAGCTGCAAGTGTGCCTCCAACTATGCCACATGTATACCAGAGCATTTTCACATGCAGGCAGAGTCATTGATTAAGCCCCTGATGCAAACTATTTCACACCAACATTCTAAAGTGCGTGTCGCTGTTATTCAGACAACTGGAACAGTTATACAGTACAGCAGTGGGAAGTCTGTGGAATGATGTTTTGTCTCATCTTGGCCAGCAACTTTTTTGAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCGGAGGGTGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837595
dbEST ID: 79655297
Trimmed Sequence: CGTGCATTCTGTAGGAGTCGGGCTTGTGTACTTCTGAATGTAATGTAAAAGCTGATCACAGTAAGCTGGAGATCTGTGCTTGTGTCGGACTGCTTCTATTTCTTGCACTAACAGGGATGGGCAGACAGCACTTCCTTCCTTCAGCAGATCTAGAACAATAAGTTGGAGACTTGCATCTGGATCGTCAAGATGTACTAGCAAACCTCTGTATAAAAACTCAAGATGGCCCTTATATGTAGTCCTTTCATACTCATCGGTGATGCATTTAAACCACTGATACAGGGTTTTAGCAGCTGCAACTCTAACCTCGTCAGAAGCATCATCCAGGCGCTTTAAGAGTTCAGGATAAATCTTGTTCAGTTTATCAGGGCGCAGCTGGCGTTCACAAGTACTCAGTAGAGCTGTGATAATGCAGCAAGACATTAGCCGGCACATCTTTGAGTCTTCTTCCAGTGTCGTGATGACCCGAGGCATCAAATTGTCTTCTACCTGAAGAATCTCTTGCTGTGATAGAGTTTCACTCTGAAGAAGGACCCACAGGCAGGATACAGCAACTGTTCGGATGGCTCCTGCTGTTCTCCCAGCTTGCCACTTGAGGTTTGGCACTATCATATCGTTTATGAAGCTTTCAGAATAACGATGGGAGCTGCCCCTTGGGAAGTTGACAGTTTTCCCTTTGGCTTTCACCAGCAATTTTTGACCAGCATTTGTGAA
Full Trace Sequence: GGGAATAAGTCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACGTGCATTCTGTAGGAGTCGGGCTTGTGTACTTCTGAATGTAATGTAAAAGCTGATCACAGTAAGCTGGAGATCTGTGCTTGTGTCGGACTGCTTCTATTTCTTGCACTAACAGGGATGGGCAGACAGCACTTCCTTCCTTCAGCAGATCTAGAACAATAAGTTGGAGACTTGCATCTGGATCGTCAAGATGTACTAGCAAACCTCTGTATAAAAACTCAAGATGGCCCTTATATGTAGTCCTTTCATACTCATCGGTGATGCATTTAAACCACTGATACAGGGTTTTAGCAGCTGCAACTCTAACCTCGTCAGAAGCATCATCCAGGCGCTTTAAGAGTTCAGGATAAATCTTGTTCAGTTTATCAGGGCGCAGCTGGCGTTCACAAGTACTCAGTAGAGCTGTGATAATGCAGCAAGACATTAGCCGGCACATCTTTGAGTCTTCTTCCAGTGTCGTGATGACCCGAGGCATCAAATTGTCTTCTACCTGAAGAATCTCTTGCTGTGATAGAGTTTCACTCTGAAGAAGGACCCACAGGCAGGATACAGCAACTGTTCGGATGGCTCCTGCTGTTCTCCCAGCTTGCCACTTGAGGTTTGGCACTATCATATCGTTTATGAAGCTTTCAGAATAACGATGGGAGCTGCCCCTTGGGAAGTTGACAGTTTTCCCTTTGGCTTTCACCAGCAATTTTTGACCAGCATTTGTGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACGTGCATTCTGTAGGAGT