ORFeome > heatr6 ORF1 – XORFeome v1.0

heatr6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: heatr6
Gene ID: 5772487
Gene Page ID: 5772464
ORF Xenbase ID: 17278779

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC043967
Original XGC clone length: 3525

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11016
Well Location: C02

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: AGCAAATAAAGTTTTTTTATTTTTAGACTGTATAATAGACCGTGTCTCGCTTGCCGCAAATGTTATAGAGCAAGCGGCTTTTTTATAAGTGCCAATCTTTTGTACAAAGAAAGATTGGCACATATGGTACATTTATGTATCAGGTATTTGCCCCTTGCTGCGCTCTGCTCTCTGTAGTGTAACAAAAGAGCTCGTGCTAGCACATGAGGGTCGATTATAACTTGGAGTCTACTTCCTAGCAATAAAGCTCCTTACTGCATGATCCCTAGAGTGTGGACATTCATCCGCGAGTGCCCGGCATCTACGGATGTAGACAGCGCTAGAAAACGAAGAACCTGACAATCTTAAGCGGTTTCACGGCAAGAGATCGCGATGCGAGCGCAACTGGGTGTCTTCCTTAGAATGGGGCTCTCTTCTTCTTGGCACGTTTTCATTAGCAGGAGCATCTATAATGAAGGGGAGAACTCATTGTGGTGCAAAGAACGTAGGAAGTATATAAAAAATGATGAAATATGTAAAAAGCGGTGGCGGGACCATAGTGGGTGTCACGATCTGGGGCGGTGGTAGGTTAGTGCTTTGTAAAAAAAAAGAATTGAGTGTGAGCCAAAGAGTGGCATGTGTGCGGACCCCGCGGACCAGAGGACAAATTACTTCAGTAGCTGTAAGTAATGGTGTGGGGGCGGGGCTGTTTGCTCCTGAAGAAAAACGAATATAAAAAAACAAGAAAATAATAAAAGAAAATGCCACTCGAAAAAACACAAAATAGAAATGTCACCCCATACATCTCTATTATGTTTATAGCTGGTCATCCCGCTTTAACTATAGGCTGAGCGAATTCCTGTATAATAAAAAAAACCAAATATGCCTAAGAGAACCATATATAAAGGCGGGGAGATTAACGTGCCTGGTAGATAGGGGGTTATTCCTTTTGTTGCCCTGTGGGGCGCGGAGCGGAGGCTCGGCGGGTGGGGAGTAAACCCCATATAACTAGTTCGCGATAGATTACAATAAAAAAGGGGGTATTTCAATTGTACCCCCACCCCCGACAGAGCTATCCTACATGAAAGGGGGGGGGCAAAACCTAAAAATTTTCTCTGTTTTGTTTGTCCACGACTTGGCCGGGGGAGACAGAGAAAAATATAAAGGGAGGAGGGGCCACAACTATAAACAAAAAAAGTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCCCAGGAAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ840241
dbEST ID: 79657943
Trimmed Sequence: CAATGCTTCCATTTCTTTGTCACAGCTCACTAAAATGGCTTCAAAATAAGCCACTTCAATGAGACCTTTATTGCTTCCAGGCAGTTCCTCAAAACCCCTTATATGTTCTATTGCTCTTTGAAGCATTTTGCCTCTGTCTTGATGTTCTCTCTGTGATTCATCCCCTTGGACTTCTGATTTCACATAATGCAATACATAATTTCTGATTGAATCCCCTTTCTCCAGCAGAGTTTTCCTAATTCTAGGCAAGTCTTCCTGGGTGGCCAAGCTGACCACATGTATCAACGAAGGACGCATTAGTTCACATCAACGATCACTATATTTAAGCAACAAACAGGTCACTATATCTCCAAACAAAATCATTATTGTCACCCCTGCCTTCCAAATATCACAATATTGTTCTGTCTATTCAATATTGCTCTCTGCTAAAAGGAATGGAAAGAGCCATTGCTGATTTTATGCGGACCTTGAAATTCTTACAGGCCTTCACAACAGTTGTAAGAGCATTGTAAGCAGCCGCTGTCCATGTAACTTTCCCAAGTGGTAAGGCTGTATTTTTAAACACATTCCCTAATGCATAGCAAGCATTCCATTTGACCTTCATGGTACCATCCCCTAGAACTGTTGAAACGAGAGCCTGTAAAGCACATTCAATGCTCTCACACAACCTTGGTTTTACAATTATGATAAGGCTGCAAAAAATGCAGCAAGATTTCCCCAAGGAACAAACAGACATTGCTCTTCCACCTTAACTTTTGTTCCTT
Full Trace Sequence: ACGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAATGCTTCCATTTCTTTGTCACAGCTCACTAAAATGGCTTCAAAATAAGCCACTTCAATGAGACCTTTATTGCTTCCAGGCAGTTCCTCAAAACCCCTTATATGTTCTATTGCTCTTTGAAGCATTTTGCCTCTGTCTTGATGTTCTCTCTGTGATTCATCCCCTTGGACTTCTGATTTCACATAATGCAATACATAATTTCTGATTGAATCCCCTTTCTCCAGCAGAGTTTTCCTAATTCTAGGCAAGTCTTCCTGGGTGGCCAAGCTGACCACATGTATCAACGAAGGACGCATTAGTTCACATCAACGATCACTATATTTAAGCAACAAACAGGTCACTATATCTCCAAACAAAATCATTATTGTCACCCCTGCCTTCCAAATATCACAATATTGTTCTGTCTATTCAATATTGCTCTCTGCTAAAAGGAATGGAAAGAGCCATTGCTGATTTTATGCGGACCTTGAAATTCTTACAGGCCTTCACAACAGTTGTAAGAGCATTGTAAGCAGCCGCTGTCCATGTAACTTTCCCAAGTGGTAAGGCTGTATTTTTAAACACATTCCCTAATGCATAGCAAGCATTCCATTTGACCTTCATGGTACCATCCCCTAGAACTGTTGAAACGAGAGCCTGTAAAGCACATTCAATGCTCTCACACAACCTTGGTTTTACAATTATGATAAGGCTGCAAAAAATGCAGCAAGATTTCCCCAAGGAACAAACAGACATTGCTCTTCCACCTTAACTTTTGTTCCTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAATGCTTCCATTTCTTTGTCAC