ORFeome > hebp2 ORF1 – XORFeome v1.0

hebp2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hebp2
Gene ID: 865869
Gene Page ID: 489460
ORF Xenbase ID: 17278785

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC122476
Original XGC clone length: 627

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: D11

Sequences - 5ʹ (forward) EST

Accession: JZ838131
dbEST ID: 79655833
Trimmed Sequence: ATGAACAACATGGGGACCCTGTTACTGCTGAGCCTGCTCTCTCTCTGTGGCACTGCAGTGAGGGCTGAAGAAGGGGCTTCTACTGATGGCAAGTTTCCTGAATTCTGTGGCGATCGAGAATGTCCAAAATTTCATCTGGTGCAGCAATATGATTCTTTCGAGCTCCGAGCTTATGAAGGAACCCAGTGGGTCACAACAGAGCTGGATGATGGATTCCTAGGCTTTGGTATGGTCACAAGCTTCAGGCGCTTATTTAATTATATCTCTGGCAAGAACTCCCAAGGAATAAAGATTGAAATGACTGTGCCGGTACTCATGCAATACCCATCAAAAGACACCGGCTGCAATGCTACTATGTCCTTCTTCTTGTCACCTTCCCTGGTGAATCCTCCTCAACCATTGGACCCCGCTGTTCATCTTGAAAACTCTCCCCCATTATTTGTATATGTCTTGTCCTTCGGAGGCTATGCATTGGACTATGACTATNAGAAGAAAGCCAAAGCACTTGCAGAAAAGCTGGGAAACCAGGGACTGTCTTTCGATGATTCCGTCCGCACAACTGCAGGCTACAATGATCCATTTACGCTGCTTAATCGGCACAATGAAGTCTGGTACAAAGCAAAATTT
Full Trace Sequence: CCGAGGCCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACAACATGGGGACCCTGTTACTGCTGAGCCTGCTCTCTCTCTGTGGCACTGCAGTGAGGGCTGAAGAAGGGGCTTCTACTGATGGCAAGTTTCCTGAATTCTGTGGCGATCGAGAATGTCCAAAATTTCATCTGGTGCAGCAATATGATTCTTTCGAGCTCCGAGCTTATGAAGGAACCCAGTGGGTCACAACAGAGCTGGATGATGGATTCCTAGGCTTTGGTATGGTCACAAGCTTCAGGCGCTTATTTAATTATATCTCTGGCAAGAACTCCCAAGGAATAAAGATTGAAATGACTGTGCCGGTACTCATGCAATACCCATCAAAAGACACCGGCTGCAATGCTACTATGTCCTTCTTCTTGTCACCTTCCCTGGTGAATCCTCCTCAACCATTGGACCCCGCTGTTCATCTTGAAAACTCTCCCCCATTATTTGTATATGTCTTGTCCTTCGGAGGCTATGCATTGGACTATGACTATNAGAAGAAAGCCAAAGCACTTGCAGAAAAGCTGGGAAACCAGGGACTGTCTTTCGATGATTCCGTCCGCACAACTGCAGGCTACAATGATCCATTTACGCTGCTTAATCGGCACAATGAAGTCTGGTACAAAGCAAAATTTGCCACTTTCTTGTACAAAGTTGGCATTATTAGAAAGCATTGCTTATCAATTTGGTTGCAACGAACAAGGTCACTATCAATCCAAAATAAATCATTATTTTGCCCTTCCGCTGAATATCCCCCCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATTGTTTTCCGGGCGACCTCTGGGCCCCGTTCAGAAAAAAAACACACTCTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACAACATGGGGACCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838130
dbEST ID: 79655832
Trimmed Sequence: CTTTGCTTTGTACCAGACTTCATTGTGCCGATTAAGCAGCGTAAATGGATCATTGTAGCCTGCAGTTGTGCGGACGGAATCATCGAAAGACAGTCCCTGGTTTCCCAGCTTTTCTGCAAGTGCTTTGGCTTTCTTCTTATAGTCATAGTCCAATGCATAGCCTCCGAAGGACAAGACATATACAAATAATGGGGGAGAGTTTTCAAGATGAACAGCGGGGTCCAATGGTTGAGGAGGATTCACCAGGGAAGGTGACAAGAAGAAGGACATAGTAGCATTGCAGCCGGTGTCTTTTGATGGGTATTGCATGAGTACCGGCACAGTCATTTCAATCTTTATTCCTTGGGAGTTCTTGCCAGAGATATAATTAAATAAGCGCCTGAAGCTTGTGACCATACCAAAGCCTAGGAATCCATCATCCAGCTCTGTTGTGACCCACTGGGTTCCTTCATAAGCTCGGAGCTCGAAAGAATCATATTGCTGCACCAGATGAAATTTTGGACATTCTCGATCGCCCCAGAATTCAAGAAACTTGCCATCAGTAGAAGCCCCTTCTTCATCCCTCACTGCAGTGCCGCAAAAAGAAAGCAGGCTCGGCGGAAACAGGGGTCCCAGGGTTTTCAAGGGGGCCAACTTTGTTTGTACAAAGTTTGGCTTTAAAAAAAAACAATTTGTGCATCCAATTTGTTGGCAACGGAAGAGGGTCACCTATCAAATTCCAAAAAAAAAAAAAAATAAATTTAGAATACCAAAAAACATTTAAGAACGGGGG
Full Trace Sequence: CGGTAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTTGCTTTGTACCAGACTTCATTGTGCCGATTAAGCAGCGTAAATGGATCATTGTAGCCTGCAGTTGTGCGGACGGAATCATCGAAAGACAGTCCCTGGTTTCCCAGCTTTTCTGCAAGTGCTTTGGCTTTCTTCTTATAGTCATAGTCCAATGCATAGCCTCCGAAGGACAAGACATATACAAATAATGGGGGAGAGTTTTCAAGATGAACAGCGGGGTCCAATGGTTGAGGAGGATTCACCAGGGAAGGTGACAAGAAGAAGGACATAGTAGCATTGCAGCCGGTGTCTTTTGATGGGTATTGCATGAGTACCGGCACAGTCATTTCAATCTTTATTCCTTGGGAGTTCTTGCCAGAGATATAATTAAATAAGCGCCTGAAGCTTGTGACCATACCAAAGCCTAGGAATCCATCATCCAGCTCTGTTGTGACCCACTGGGTTCCTTCATAAGCTCGGAGCTCGAAAGAATCATATTGCTGCACCAGATGAAATTTTGGACATTCTCGATCGCCCCAGAATTCAAGAAACTTGCCATCAGTAGAAGCCCCTTCTTCATCCCTCACTGCAGTGCCGCAAAAAGAAAGCAGGCTCGGCGGAAACAGGGGTCCCAGGGTTTTCAAGGGGGCCAACTTTGTTTGTACAAAGTTTGGCTTTAAAAAAAAACAATTTGTGCATCCAATTTGTTGGCAACGGAAGAGGGTCACCTATCAAATTCCAAAAAAAAAAAAAAATAAATTTAGAATACCAAAAAACATTTAAGAACGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTGCTTTGTACCAGACTTCATT