ORFeome > herpud1 ORF1 – XORFeome v1.0

herpud1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: herpud1
Gene ID: 922371
Gene Page ID: 922357
ORF Xenbase ID: 17278815

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054211
Original XGC clone length: 1092

Human orthology & disease relationships

NCBI Entrez ID: 9709
Ensembl gene IDs: ENSG00000051108
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: D10

Sequences - 5ʹ (forward) EST

Accession: JZ839421
dbEST ID: 79657123
Trimmed Sequence: ATGTCGGACGGAGAAGTAACTTTGCTTATACGGAGCCCTAGCCTTAGGCAGGAGGAAAGAGAGGTCCGTGTACCTCGTAATTGTACTGTGCGTGAACTAAAAACACAACTACGACAAGAACTGCCAGGGGAACCGATGGAACAAGATCAGAGATTGATCTATGCTGGAAAGTTGCTTCCTGATCATCTAAAGCTAAATGAAGTTCTTTCTATGGAGAGCAGACATGTACTGCACCTTGTTTGTTCCAAACGGATTCCTGTAAATCAGGACAGCAGCCAACATCCTGCATGTACATCTGCTCAACCTCACACTGTGAATCCTGAGGCTGATGGCATTAGACAACGGATCCCTCCACAAAACAATTCTGCAGAGAATGGCAACACAGCTAGGCCTCAAGAAGCAAGTCCTGCAATTTCTGCTTACCCAGTATACAGTCCCCAACAGATCATGTGGCTTCAACACATGTATGCCAGACAGTACTACATGCAATACTATGCTGCTGCTGCAGCTGGTAGGTCCCCTATTCAGAGAGGCCAGGAAATCCCAGTGGTTCCGCCTGCTGCACCAGACCCGTTACCTCTTCCTTTTCCAGCAAACCAACCACAGAATTCCAGAAGTTCAAGCTCCCAGTTATTCCAGTGGCCAATCCCCATTTGCGTATGAATGCTCAGGGGAGGACTGGGTGGAGAAAAAAGATGAAGGTTCACAGAGACGGGGCGGGAACGGGATCCTATACGGCTTGCAAGAATTCCCCATTCTTCCTTGAAATATCCGGTATATTTTTACTCCCAAGTCGGGAACCCG
Full Trace Sequence: CTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCGGACGGAGAAGTAACTTTGCTTATACGGAGCCCTAGCCTTAGGCAGGAGGAAAGAGAGGTCCGTGTACCTCGTAATTGTACTGTGCGTGAACTAAAAACACAACTACGACAAGAACTGCCAGGGGAACCGATGGAACAAGATCAGAGATTGATCTATGCTGGAAAGTTGCTTCCTGATCATCTAAAGCTAAATGAAGTTCTTTCTATGGAGAGCAGACATGTACTGCACCTTGTTTGTTCCAAACGGATTCCTGTAAATCAGGACAGCAGCCAACATCCTGCATGTACATCTGCTCAACCTCACACTGTGAATCCTGAGGCTGATGGCATTAGACAACGGATCCCTCCACAAAACAATTCTGCAGAGAATGGCAACACAGCTAGGCCTCAAGAAGCAAGTCCTGCAATTTCTGCTTACCCAGTATACAGTCCCCAACAGATCATGTGGCTTCAACACATGTATGCCAGACAGTACTACATGCAATACTATGCTGCTGCTGCAGCTGGTAGGTCCCCTATTCAGAGAGGCCAGGAAATCCCAGTGGTTCCGCCTGCTGCACCAGACCCGTTACCTCTTCCTTTTCCAGCAAACCAACCACAGAATTCCAGAAGTTCAAGCTCCCAGTTATTCCAGTGGCCAATCCCCATTTGCGTATGAATGCTCAGGGGAGGACTGGGTGGAGAAAAAAGATGAAGGTTCACAGAGACGGGGCGGGAACGGGATCCTATACGGCTTGCAAGAATTCCCCATTCTTCCTTGAAATATCCGGTATATTTTTACTCCCAAGTCGGGAACCCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGGACGGAGAAGTAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839420
dbEST ID: 79657122
Trimmed Sequence: GTGAACCACAGCAGGAGGCCCTTCAGGAATCAATGATGCAAAGAATGTTTTGAAGAAAATCCAGGCTGTTGTCAAAAACGATTGTGCTTGGAGAGTGGCAGCTTCAGTTCCGTCAGCAGAAGGATCCTCAATCTGATCATCTTCTTCCTGCTGTAGGTTGTTGTTCTGATCCTGGTGATTGGGGACAGCCCTTGGAGGGATATTTACATTTGCAGCTTCCTCAGGGGGGGGTCTTGGTCTGAATGGAAACCATCCAGCATGGTGCAAGTACATGAGAATCATGGCACCCAAGACCATCATAAAGCGGCTCAGACTGGAGTAAAAGTACAGAATACTCAGGAAGATGGAGAATCGTGCAGCTGTATAGATCCAGTCCAGCCAGTCTCTGTGAACATCATCCTCTTCTTCCACCAGTCCTCCCTGAGCATTCATACGCAAATTGGGATTGGCCACTGGATTAACTGGAGCTTGAACTTCTGGATTCTGTGGTTGGTTTGCTGGAAAAGGATGAGGTAACGGGTCTGGTGCAGCAGGTGGAACCACTGGGATTTCCTGGCCTCTCTGAATAGGGGACCTACCAGCTGCAGCAGCAGCATAGTATTGCATGTAGTACTGTCTGGCATACATGTGTTGAAGCACATGATCTTGTTGGGGACTGTAAACTGGGGTAAGCAAAAATTTGCAGGACTTTGCTTCTTGAGGGCCTAACCTGTGGTGCCCCTTTCCTCTTGCAAAAATTGTTTTTTGTGGGGAA
Full Trace Sequence: ACGGGAAACTGTCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGAACCACAGCAGGAGGCCCTTCAGGAATCAATGATGCAAAGAATGTTTTGAAGAAAATCCAGGCTGTTGTCAAAAACGATTGTGCTTGGAGAGTGGCAGCTTCAGTTCCGTCAGCAGAAGGATCCTCAATCTGATCATCTTCTTCCTGCTGTAGGTTGTTGTTCTGATCCTGGTGATTGGGGACAGCCCTTGGAGGGATATTTACATTTGCAGCTTCCTCAGGGGGGGGTCTTGGTCTGAATGGAAACCATCCAGCATGGTGCAAGTACATGAGAATCATGGCACCCAAGACCATCATAAAGCGGCTCAGACTGGAGTAAAAGTACAGAATACTCAGGAAGATGGAGAATCGTGCAGCTGTATAGATCCAGTCCAGCCAGTCTCTGTGAACATCATCCTCTTCTTCCACCAGTCCTCCCTGAGCATTCATACGCAAATTGGGATTGGCCACTGGATTAACTGGAGCTTGAACTTCTGGATTCTGTGGTTGGTTTGCTGGAAAAGGATGAGGTAACGGGTCTGGTGCAGCAGGTGGAACCACTGGGATTTCCTGGCCTCTCTGAATAGGGGACCTACCAGCTGCAGCAGCAGCATAGTATTGCATGTAGTACTGTCTGGCATACATGTGTTGAAGCACATGATCTTGTTGGGGACTGTAAACTGGGGTAAGCAAAAATTTGCAGGACTTTGCTTCTTGAGGGCCTAACCTGTGGTGCCCCTTTCCTCTTGCAAAAATTGTTTTTTGTGGGGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGAACCACAGCAGGAG