ORFeome > herpud1 ORF2 – XORFeome v1.0

herpud1 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: herpud1
Gene ID: 6254221
Gene Page ID: 922357
ORF Xenbase ID: 17278821

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046268
Original XGC clone length: 1095

Human orthology & disease relationships

NCBI Entrez ID: 9709
Ensembl gene IDs: ENSG00000051108
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11017
Well Location: G03

Sequences - 5ʹ (forward) EST

Accession: JZ824363
dbEST ID: 79642065
Trimmed Sequence: ATGTCGGACAGCGAAGTAACTTTACTCATACGGAGTCCCAGCCTTAGGCAGGAGGAAAGGGAGGTCAGTGCACCTCGGAATTGTACCGTCCGTGAACTAAAAACACAGCTAAGACGAGAACTACCCGATGAGCCGATGGAACAAGATCAGCGATTGATCTATGCTGGGAAGTTGCTTCCTGATCATCTAAAGCTAAATGAAGTTCTTTCTATGGACAGCAGACATGTACTGCACCTTGTTTGTTCCAAAAGGATCCCTGTTAATCAGGACAGTAGCCAACATTCTGGATGTACATCTGCTCGACCTCACACTGTAAATCCTGAGGCTGATGTTATTCGACAACGGATTCCTCCACAAAACAATACTGCAGAAGATGCAAACACAGCTAGGCCTCGAGAACCAAGTTCTGCATTTTCTGCTTACTCGGTATACAGTCCACAACAAATCATGTGGCTTCAACACATGTATGCCAGACAATACTACATGCAATACTATGCTGCTGCTGCAGCTGGTAGGTCCCCTGTTCATAGAATACAGGAAATCCCAGTGGTTCCACCTGCAGCACCAGACCCGTTACCACATCCGTTCCAAGGGAACAACCATCCACAGAATCCAGAAGTTCAGGCTCCAGTTAATCCAGTGGCCATCCCTAATTTGCGTATGACGCTCAAGGGAGACTGGTTGGAAAANNGAGGATGATGTTNCACGGAGACCTGGCTGGGACTGGATCTACACAAGCGGCACGATCTTCCTTCTTTCTGAGTAATCTCTTATTTCTACTTCCAGTCTGAACCCCTTTTAAAAAGGGGCTTGGGGGGTCCCGGGGG
Full Trace Sequence: CAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCGGACAGCGAAGTAACTTTACTCATACGGAGTCCCAGCCTTAGGCAGGAGGAAAGGGAGGTCAGTGCACCTCGGAATTGTACCGTCCGTGAACTAAAAACACAGCTAAGACGAGAACTACCCGATGAGCCGATGGAACAAGATCAGCGATTGATCTATGCTGGGAAGTTGCTTCCTGATCATCTAAAGCTAAATGAAGTTCTTTCTATGGACAGCAGACATGTACTGCACCTTGTTTGTTCCAAAAGGATCCCTGTTAATCAGGACAGTAGCCAACATTCTGGATGTACATCTGCTCGACCTCACACTGTAAATCCTGAGGCTGATGTTATTCGACAACGGATTCCTCCACAAAACAATACTGCAGAAGATGCAAACACAGCTAGGCCTCGAGAACCAAGTTCTGCATTTTCTGCTTACTCGGTATACAGTCCACAACAAATCATGTGGCTTCAACACATGTATGCCAGACAATACTACATGCAATACTATGCTGCTGCTGCAGCTGGTAGGTCCCCTGTTCATAGAATACAGGAAATCCCAGTGGTTCCACCTGCAGCACCAGACCCGTTACCACATCCGTTCCAAGGGAACAACCATCCACAGAATCCAGAAGTTCAGGCTCCAGTTAATCCAGTGGCCATCCCTAATTTGCGTATGACGCTCAAGGGAGACTGGTTGGAAAANNGAGGATGATGTTNCACGGAGACCTGGCTGGGACTGGATCTACACAAGCGGCACGATCTTCCTTCTTTCTGAGTAATCTCTTATTTCTACTTCCAGTCTGAACCCCTTTTAAAAAGGGGCTTGGGGGGTCCCGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGGACAGCGAAGTAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829722
dbEST ID: 79647424
Trimmed Sequence: GTGAACCATGGCAGGGGGACCTTCAGGAATCAATGATGCAAAGAATGTTTTGAAGAAAATCCAGGCTGTTGTCACAAATGGTTGTGCTTGAAGAGTGTCAGTTTCATTTCCATCAGCTGAAGGATCCTCTATATGATCATCTTCTTCCTGCTGTAAGTTGTTATTCTGATCCTGGTGATTGGGGGCAGCCCTTGGAGGGATATTTACATTTGCAGCTTCCTCAGGGGGAGGTCTTGGTCTGAATGGAAACCATCCAGCATGGTGCAAGTACATGAGAACCATGGCACCCAAGACCATCATAAAGCGGCTCAGACTGGAGTAGAAGTAGAGAATACTCAGGAAGATGGAGAATCGTGCCGCTGTGTAGATCCAGTCCAGCCAGTCTCTGTGAACATCATCCTCTTCTTCCACCAGTCCTCCCTGAGCGTTCATACGCAAATTAGGATTGGCCACTGGATTAACTGGAGCCTGAACTTCTGGATTCTGTGGATGGTTGTTCCCTTGGAACGGATGTGGTAACGGGTCTGGTGCTGCAGGTGGAACCACTGGGATTTCCTGTATTCTATGAACAGGGGACCTACCAGCTGCAGCAGCAGCATAGTATTGCATGTAGTATTGTCTGGCATACATGTGTTGAAGCCACATGGATTTGTTGTGGACTGTATACCGAGTAAGCAGAAAATGGCAGAACTTGGTTCTCGAAGCCCTACCTGTGTTTGCATCTTTCCGCAATTATTGGTTTTGGTGGGAG
Full Trace Sequence: GGCAGCGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGAACCATGGCAGGGGGACCTTCAGGAATCAATGATGCAAAGAATGTTTTGAAGAAAATCCAGGCTGTTGTCACAAATGGTTGTGCTTGAAGAGTGTCAGTTTCATTTCCATCAGCTGAAGGATCCTCTATATGATCATCTTCTTCCTGCTGTAAGTTGTTATTCTGATCCTGGTGATTGGGGGCAGCCCTTGGAGGGATATTTACATTTGCAGCTTCCTCAGGGGGAGGTCTTGGTCTGAATGGAAACCATCCAGCATGGTGCAAGTACATGAGAACCATGGCACCCAAGACCATCATAAAGCGGCTCAGACTGGAGTAGAAGTAGAGAATACTCAGGAAGATGGAGAATCGTGCCGCTGTGTAGATCCAGTCCAGCCAGTCTCTGTGAACATCATCCTCTTCTTCCACCAGTCCTCCCTGAGCGTTCATACGCAAATTAGGATTGGCCACTGGATTAACTGGAGCCTGAACTTCTGGATTCTGTGGATGGTTGTTCCCTTGGAACGGATGTGGTAACGGGTCTGGTGCTGCAGGTGGAACCACTGGGATTTCCTGTATTCTATGAACAGGGGACCTACCAGCTGCAGCAGCAGCATAGTATTGCATGTAGTATTGTCTGGCATACATGTGTTGAAGCCACATGGATTTGTTGTGGACTGTATACCGAGTAAGCAGAAAATGGCAGAACTTGGTTCTCGAAGCCCTACCTGTGTTTGCATCTTTCCGCAATTATTGGTTTTGGTGGGAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGAACCATGGCAGGGGGA