ORFeome > hes1 ORF3 – XORFeome v1.0

hes1 ORF3 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hes1
Gene ID: 6256448
Gene Page ID: 487994
ORF Xenbase ID: 17278845

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128932
Original XGC clone length: 804

Human orthology & disease relationships

NCBI Entrez ID: 3280
Ensembl gene IDs: ENSG00000114315
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 173100,209950,219050,262400,262650,266600,274500,600802,601665,609135

Library Location

Plate ID: GDExl11086
Well Location: A03

Sequences - 5ʹ (forward) EST

Accession: JZ837876
dbEST ID: 79655578
Trimmed Sequence: ATGCCGGCTGATGTGATGGAGAAGAACTCCTCATCCCCAGTGGCTGCCACTCCGGCCAGTGTGAGCAATACCCCGGATAAACCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCCGGATCAACGAGAGCCTCGGGCAACTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTAGAGAAGGCTGATATACTAGAGATGACAGTAAAGCACCTGAGGAACCTGCAGCGGGTACAGATGACTGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTTAGCGAGTGCATGAATGAAGTAACTCGATTCTTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCGTGAATCAGATACATGCCATGAATTACCCTGCCCAGCCTCAGATCCCTTCTGCAGCCGCACCCCATCCTGCCTATGGACAGCCTATGGTCCAGCTCCCACCAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCTTGCAAAAAGGGTGGTCCCACCATTAAAAACTGCCCAATTGTATGGAAGCTTCCAGGCTTGTGCCAGCTTCAAATGGACAGTTTGGCTTTCCTGATCACAAACCAACCTTTCCCTCAAAAACGATCTTTTCATTCCTTTAAACCCAACTCCAATGGTGGCCCCTGGCCGGCCCCCCCTTCATTTTCCCCCTTCATTAATGCCCTCCCATTCCCAGCCTGGCCCCGTTTTTGGGAAGGCCCTTGGGGTGGC
Full Trace Sequence: TCGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCGGCTGATGTGATGGAGAAGAACTCCTCATCCCCAGTGGCTGCCACTCCGGCCAGTGTGAGCAATACCCCGGATAAACCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCCGGATCAACGAGAGCCTCGGGCAACTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTAGAGAAGGCTGATATACTAGAGATGACAGTAAAGCACCTGAGGAACCTGCAGCGGGTACAGATGACTGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTTAGCGAGTGCATGAATGAAGTAACTCGATTCTTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCGTGAATCAGATACATGCCATGAATTACCCTGCCCAGCCTCAGATCCCTTCTGCAGCCGCACCCCATCCTGCCTATGGACAGCCTATGGTCCAGCTCCCACCAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCTTGCAAAAAGGGTGGTCCCACCATTAAAAACTGCCCAATTGTATGGAAGCTTCCAGGCTTGTGCCAGCTTCAAATGGACAGTTTGGCTTTCCTGATCACAAACCAACCTTTCCCTCAAAAACGATCTTTTCATTCCTTTAAACCCAACTCCAATGGTGGCCCCTGGCCGGCCCCCCCTTCATTTTCCCCCTTCATTAATGCCCTCCCATTCCCAGCCTGGCCCCGTTTTTGGGAAGGCCCTTGGGGTGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCGGCTGATGTGATGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837875
dbEST ID: 79655577
Trimmed Sequence: CCAGGGCCTCCAAACAGAGTCAGCTGTGACTGATGGCATTACTGAAGGAGACACTGAAGGTGGCAGTGCAGTGCCCACATTGGAGTTGGTGTATAAAGGAATGACAGATCCGTTCTGAGGGAAAGCTGGGTTTGTGATCAGGAAGGCAAACTGTCCATCTGAAGCTGGCACAAGCTGGAAGCCTCCATACACTTTGGCAGCTTCTACTGGTGGACCACCCATCTTGCAAGCAATGGGAGCTGGGCTGCTCTGTGGAGCTGCTGCTGGGAGCTGGACCATAGGCTGTCCATAGGCAGGATGGGGTGCGGCTGCAGAAGGGATCTGAGGCTGGGCAGGGTAATTCATGGCATGTATCTGATTCACGCAGTTGGCAAGATGCCCCAGGAGTCGGGTCCGGACATCTGTGTTGACCCCTTCACAGGTAGACAAAAATCGAGTTACTTCATTCATGCACTCGCTAAATCCAGCTCTGTACTTGCCCAGTACTGAAGGGTCTGTACTCAATGCAGCAGTCATCTGTACCCGCTGCAGGTTCGTGAGGTGCTTTACAAGTCATCGCTAATATATCAACCTGCTCTACCGTTGGAGTGGCGGGAGCTAGCTTTCTTGAGCGCAGCCAGGATGAGGGTTGTGAGGTTCCCAAGACTCGCGGTGGATCGGGCTCGGCGTTGCGTCTCTATAAGGGACATGGAGGGGGGAGAGTGCTTCGGGGGGGGGTGGGGGGTTGTGGGGGATGGAGGGGGACGGGGCGGAGGGGGCGGCAGCTGGGGAAAAGGAGAAGTGAACAATCACTCAAACCAGAGAGGGGGGAGGGTGGTGTATTTATGAGGGGGGGGTAGGAGAAAAAAAAAATATATGGGGTGCAATGGCGGGGGGGGGAGGGCAAAAAAAAAAAGGAAGAAAAAAATATATTACATGTCGCTGCGTAATAAATAAAACAAAATCCCCCTCACTAAGTCCGGCGGGCGGGGGGGGGGGGGGGGGGTCTCTTTTTTATAAATTATGTAAGGGCACCCACTCCGCGCCGCGTANNGTGTGAGACCCGAGGAAGGAGAAAAAGGAAAANGGGGAAAACGCCGGGCCCGCGGGGGGGGGAAGGGNNGGGANNGAGGNGGNGGGGGGGGAGGGGAGNNGGANGGAAGGGGGGAGGGAGAGGGGGGGNTNNGGGGNGGGAAGGGGAGGGGNGGGGNNANNGGANNNGGGGGGGNGGGAGGNAAGGNGNGNGN
Full Trace Sequence: GGGCAGGGGACAGGCTATGGACCATGTAATACGACTCACTATNAGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCAGGGCCTCCAAACAGAGTCAGCTGTGACTGATGGCATTACTGAAGGAGACACTGAAGGTGGCAGTGCAGTGCCCACATTGGAGTTGGTGTATAAAGGAATGACAGATCCGTTCTGAGGGAAAGCTGGGTTTGTGATCAGGAAGGCAAACTGTCCATCTGAAGCTGGCACAAGCTGGAAGCCTCCATACACTTTGGCAGCTTCTACTGGTGGACCACCCATCTTGCAAGCAATGGGAGCTGGGCTGCTCTGTGGAGCTGCTGCTGGGAGCTGGACCATAGGCTGTCCATAGGCAGGATGGGGTGCGGCTGCAGAAGGGATCTGAGGCTGGGCAGGGTAATTCATGGCATGTATCTGATTCACGCAGTTGGCAAGATGCCCCAGGAGTCGGGTCCGGACATCTGTGTTGACCCCTTCACAGGTAGACAAAAATCGAGTTACTTCATTCATGCACTCGCTAAATCCAGCTCTGTACTTGCCCAGTACTGAAGGGTCTGTACTCAATGCAGCAGTCATCTGTACCCGCTGCAGGTTCGTGAGGTGCTTTACAAGTCATCGCTAATATATCAACCTGCTCTACCGTTGGAGTGGCGGGAGCTAGCTTTCTTGAGCGCAGCCAGGATGAGGGTTGTGAGGTTCCCAAGACTCGCGGTGGATCGGGCTCGGCGTTGCGTCTCTATAAGGGACATGGAGGGGGGAGAGTGCTTCGGGGGGGGGTGGGGGGTTGTGGGGGATGGAGGGGGACGGGGCGGAGGGGGCGGCAGCTGGGGAAAAGGAGAAGTGAACAATCACTCAAACCAGAGAGGGGGGAGGGTGGTGTATTTATGAGGGGGGGGTAGGAGAAAAAAAAAATATATGGGGTGCAATGGCGGGGGGGGGAGGGCAAAAAAAAAAAGGAAGAAAAAAATATATTACATGTCGCTGCGTAATAAATAAAACAAAATCCCCCTCACTAAGTCCGGCGGGCGGGGGGGGGGGGGGGGGGTCTCTTTTTTATAAATTATGTAAGGGCACCCACTCCGCGCCGCGTANNGTGTGAGACCCGAGGAAGGAGAAAAAGGAAAANGGGGAAAACGCCGGGCCCGCGGGGGGGGGAAGGGNNGGGANNGAGGNGGNGGGGGGGGAGGGGAGNNGGANGGAAGGGGGGAGGGAGAGGGGGGGNTNNGGGGNGGGAAGGGGAGGGGNGGGGNNANNGGANNNGGGGGGGNGGGAGGNAAGGNGNGNGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCAGGGCCTCCAAACAGAGTCA